1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena L [17]
2 years ago
7

In bacterial infections, the resulting mass of white blood cells, bacterial cells, and

Biology
1 answer:
RSB [31]2 years ago
7 0

the resulting mass is the pus

You might be interested in
A convergent boundary is a location where tectonic plates move toward each other. which feature of the ocean floor is caused by
pav-90 [236]

Answer:

At convergent plate boundaries, oceanic crust is often forced down into the mantle where it begins to melt. Magma rises into and through the other plate, solidifying into granite, the rock that makes up the continents. Thus, at convergent boundaries, continental crust is created and oceanic crust is destroyed.

Explanation:

3 0
2 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Sentences with the word know
chubhunter [2.5K]
Hi There! 

<span>Sentences with the word know

I think you're asking to write a sentences with the word know!

Example: I know you can do it Cutiepie

Example #2: Do you know who Ms.Cutiepie is?</span>
7 0
3 years ago
Read 2 more answers
What kinds of environmental factors might cause the Marfan syndrome gene to affect two siblings very differently?
Nataliya [291]
Heart,eyes,blood vessels and skeleton people.
8 0
2 years ago
When quitting smoking, stress-management techniques can?
jekas [21]
Help ease people through the withdrawal process.
3 0
3 years ago
Other questions:
  • Can someone help me please
    7·2 answers
  • Which of the following is NOT one of the four main groups of macromolecules of living things?
    6·2 answers
  • Gases pass in and out of a leaf through the what?
    7·1 answer
  • URGENT PLS HELP MEEEE --- How are the Atomic number, Mass number, and Atomic mass diffrent from eachother?
    10·1 answer
  • Why have so many bacteria now able to resist antibiotics
    7·1 answer
  • Which statement BEST explains the genetics represented by the cladogram?
    11·1 answer
  • Is there DNA in your food? How do you know?
    15·1 answer
  • Which option is it? Please help
    8·2 answers
  • Which statement best explains why the classification
    13·1 answer
  • Why is the research on plant material mentioned in the article important to Rohit Karnik’s work on membranes?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!