1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lakkis [162]
3 years ago
5

What do scientist use trilobites as proof of

Biology
2 answers:
kirill [66]3 years ago
6 0

Answer:

Explanation:

Because they appeared quickly in geological time, and moulted like other arthropods, trilobites serve as excellent index fossils, enabling geologists to date the age of the rocks in which they are found. They were among the first fossils to attract widespread attention, and new species are being discovered every year.

natka813 [3]3 years ago
5 0
Trilobites are known as index fossils, fossils used by scientists to make inferences on the ages of rock layers. “Trilobites allow geologists to date the rocks they are found in and correlate them with other rocks of similar ages around the world,” Dr.
You might be interested in
Tissues are composed of the same kind of<br> a. bones <br> b. cells
Nikitich [7]
Tissues are composed of the same kind of cell
5 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Describe Natural influences in the Alpine Biome. 10 Points total.
Arisa [49]
<span>In general, as one ascends a mountain, temperature drops by about 10 C for every 1000 meters in altitude gained (a suspiciously round number!). 
I hope I helped!!</span>
7 0
3 years ago
Carbon becomes part of the carbon cycle in several ways, both by physical and chemical means. Carbon enters a food web via _____
raketka [301]

The carbon is among the most abundant element found in the living organisms. The carbon enters the food web through the producers via the process by which they make their food, which is known as photosynthesis. The plants during the process of photosynthesis, take in carbondioxide, water and capture the sunlight to make ATP. The carbon from all these elements enters the producers and then is passed on from one trophic level to another.

Hence, the blanks can be filled with 'producers, and photosynthesis'.

7 0
3 years ago
Read 2 more answers
The picture shows a model of a cell.
Jlenok [28]

Answer:

The part Y is Chloroplast. The function of Chloroplast is C. To use energy from sunlight to make sugar

8 0
3 years ago
Read 2 more answers
Other questions:
  • Most scientists agree that saturated fats contribute to high llevelof bad cholesterol for monosaturated fats and polysaturated f
    11·2 answers
  • If all disease is eradicated and food supply exceeds demand indefinitely, the human population on the planet Earth will NOT cont
    6·1 answer
  • Which example best describes how an X-ray machine works?
    10·1 answer
  • What is a galaxy a collection of
    14·1 answer
  • Where do most crustaceans live?<br><br> in water<br> in soil<br> on rocks<br> in plants
    6·2 answers
  • Does the frontal lobe release norepinephrine that speeds up heart rate and breathing rate
    8·1 answer
  • In which muscles is overactivity or tightness common for individuals who regularly wear high heels?
    9·1 answer
  • If you have 52.4 grams of hydrogen and 52.4 grams of heliumwhich one has a greater mass ? Why?
    13·2 answers
  • Where is the ozone found? Why is it important?
    10·2 answers
  • An egg is protected by its outer shell. However, the shell also allows moisture and air to pass through. Which cell structure pe
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!