1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rus_ich [418]
3 years ago
11

Which producers are MOST efficient at pulling carbon dioxide from the atmosphere?

Biology
1 answer:
photoshop1234 [79]3 years ago
4 0

D. Phytoplankton are most efficient

You might be interested in
How do flowers contribute to the reproductive success of angiosperms?
Flura [38]
The seeds fly everywhere so therefore it is logical
7 0
3 years ago
Humans secreting pheromones is an example of which form of communication?
rosijanka [135]
I’m pretty sure it is biological because it’s your biology transporting into the other persons
4 0
3 years ago
Please help whoever’s right will get brainliest
hodyreva [135]

Answer:

1: LAW

2: THEORY

3: THEORY

4: THEORY

Explanation:

7 0
3 years ago
The information carries by DNA incorporated in a code specified by the ?
Lady_Fox [76]

Answer:

The information carried by DNA is incorporated in a code specified by the: specific nucleotide sequence of the DNA molecule. The enzyme DNA ligase is responsible for: linking short DNA segments.

Explanation:

3 0
3 years ago
Reflection and absorption by the atmosphere prevent some ____ from reaching Earth's surface.
GaryK [48]
Radiation will be ure answer
4 0
3 years ago
Read 2 more answers
Other questions:
  • A mineral crystallizes from magma deep inside Earth.
    6·2 answers
  • What is a compound that is cycled through<br> an ecosystem?
    10·1 answer
  • Hey♥️<br>list the kinds of nuitrition in bacteria​
    5·1 answer
  • What describes the physical expression of genes like having brown hair or having the ability to roll your tongue?
    15·2 answers
  • How is relative-age dating used to determine the ages of fossils?
    10·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • According to the table provided, which pond organism shares the most characteristics with animals?
    9·1 answer
  • In an experiment, 100 mice were released
    5·1 answer
  • Why are lipids better suited than carbohydrates for long-term energy storage?.
    5·1 answer
  • Due to a random error by the aminoacyl tRNA synthetase, a tRNAVal was misloaded with Ile. What do you predict will result
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!