1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BabaBlast [244]
3 years ago
13

Undigested material not absorbed by the large intestine forms what kind of waste?

Biology
1 answer:
BartSMP [9]3 years ago
3 0

Hi there!

It forms fecal waste. Fecal waste is made of whatever’s left after the large intestine absorbs the needed nutrients and minerals.

Hope this answers your question!

You might be interested in
What was the significance of natural selection to the theory of evolution?
vovikov84 [41]
The weakest died out and only the intelligent and strong survived to pass on the most useful traits, determining the way a species evolved - growing more intelligent or athletic as a result of these patterns.
3 0
3 years ago
Each biological species is genetically isolated from other species. why do the species evolve independently?
Nookie1986 [14]
Species evolve independently possibly due to geographical isolations or behavioural isolations.

Geographical isolation includes the isolation of 2 groups of the same species. Since these 2 groups live in different locations, (e.g. a volcanic eruption resulting in a barrier between one side of an ocean and another side of the ocean), they will have different selection pressures in their different environments as well (e.g. one side of the ocean may have more sunlight and thus more underwater plantations than the other side of the ocean). Natural selection will eliminate those with disadvantageous characteristics (e.g. Fishes that only eat plants and nothing else on the side of the ocean with little plantations) with unfavourable alleles, and select for those with advantageous characteristics (e.g. Fishes are able to eat plants and other organic substances as well on the side of the ocean with little plantations) with favourable alleles.

Since the 2 groups have different selection pressures, natural selection will occur in different ways, selecting for and against different types of fishes with different types of alleles. Also, because of the barrier, they are not able to mate with each other, and there are no mixing of genes from one side of the ocean and the other side. They are genetically isolated. As genetic drift occurs over time, their gene pools become different from each other. Thus, they evolve independently.

Hope this helps! :)
7 0
3 years ago
Which religion spread from India to China along trade routes
andrew-mc [135]
Buddhism was the first of the great missionary faiths to take advantage of the mobility provided by the Silk Road to extend its reach far beyond its native ground. From its origins in north eastern India, Buddhism had already spread into the lands that are now Pakistan and Afghanistan by the 1st century BCE.
3 0
3 years ago
Read 2 more answers
Need help. Will give brainliest. Answer all these questions.
agasfer [191]

Answer:

1. The daughter cells are genetically identical because they each contain the same diploid chromosome complement as the original parent cell. It can be seen in the stages shown above that mitosis maintains the chromosome number or complement of a cell.

2.  Much of the growth in an adult is attributed to the growth plate in the bones, which is line of cells at each end of the bone that divides rapidly during puberty. As the bones elongate, the muscles also elongate as they are stimulated to grow by stretching and hormonal changes. When puberty is completed, the growth plate calcifies into solid bone and can no longer grow. Muscles can continue to enlarge with athletic activities and can sometimes split with excessive force, but muscle cells typically do not continue to divide. Cells such as your skin, hair, and interior mucus surface cells continue to divide because they are in direct contact with things from the outside world. Bone marrow also continually divides to produce red and white blood cells. Many other cells in your body do not continue cell division.

3. The number of Chromosomes stay the same when the cell divides because before a cell divides it produces new copies of the Chromosomes in the nucleus so when division takes place two genetically identical 'daughter cells', containing the same genes, are formed.

4. – in cells capable of dividing, the period between cell divisions is called interphase – cells spend most of their time in interphase because this is the phase where they perform their functions (obtaining energy, synthesizing products, repair damage, fight disease, duplicate their genetic material and get ready for division)

5. Asexual reproduction is a type of reproduction that does not involve the fusion of gametes or change in the number of chromosomes. The offspring that arise by asexual reproduction from either unicellular or multicellular organisms inherit the full set of genes of their single parent. Asexual reproduction is the primary form of reproduction for single-celled organisms such as archaea and bacteria. Many eukaryotic organisms including plants, animals, and fungi can also reproduce asexually. In vertebrates, the most common form of asexual reproduction is parthenogenesis which is typically used as an alternative to sexual reproduction in times when reproductive opportunities are limited. While all prokaryotes reproduce without the formation and fusion of gametes, mechanisms for lateral gene transfer such as conjugation, transformation and transduction can be likened to sexual reproduction in the sense of genetic recombination in meiosis.

6. Since each of the parent cell’s chromosomes were replicated during interphase, there are two copies of each chromosome in the cell during prophase. Once the chromatin has condensed into individual chromosomes, the genetically-identical chromosomes come together to form an “X” shape, called sister chromatids .

Explanation:

I hope it helps!!

8 0
3 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
4 years ago
Other questions:
  • Science<br>What does equilibrium mean?
    14·2 answers
  • Why do scientists use the International System of Units (SI)?
    10·2 answers
  • Indicators are types of indirect measurements that serve as substitutes for direct measurement. *
    5·1 answer
  • Explain how heredity may have arisen
    8·2 answers
  • Role of matter in living and nonliving things
    9·2 answers
  • How would you describe extreme weather?
    13·2 answers
  • Which organ helps to process essential proteins and minerals, so that they can then be taken through the bloodstream and to the
    6·2 answers
  • From the roots up through the stems and into the leaves, replacing<br> the water used in ———— ??
    8·1 answer
  • Which of the following steps occurs in both cellular respiration and photosynthesis?
    10·1 answer
  • Endorsements by celebrities
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!