1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
valentina_108 [34]
3 years ago
6

What is the job of the carrier protein in the cell membrane

Biology
1 answer:
ki77a [65]3 years ago
3 0

Answer:

Carrier proteins move materials from one side of the cell membrane to the other. This is useful for both active transport, meaning you have to transport against the concentration gradient, and facilitated diffusion, a form of passive transport.

You might be interested in
Is ammonium nitrate crystals and a pouch of water toxic
shepuryov [24]
Under normal conditions it is not toxic

Adding ammonium nitrate to water turns the mixture cold and is a good example of an endothermic chemical reaction
5 0
2 years ago
How many sperm cells are formed from an original cell in a Drosophila fruit fly at the conclusion of meiosis?
julsineya [31]

Answer:

C. Four Haploid Sperm Cells

Explanation:

Meiosis is a cell division measure that creates four haploid cells (gametes) from a solitary diploid germline cell. In males, meiosis is essential for spermatogenesis, the cycle to produce sperm. Sperm are the haploid cells that are produced in meiosis.  

Meiosis is a profoundly moderated cell division measure in eukaryotes that produces 4 cells (gametes) from a solitary cell (mother). Nonetheless, Nondisjunction in the male of Drosophila causes much of the time sperm with an addition or loss of chromosomes.

5 0
3 years ago
The _____________ variable is the variable that is purposely changed.
Triss [41]

Answer:

dependent

Explanation:

5 0
3 years ago
Read 2 more answers
Mepolizumab and reslizumab improve asthma control by binding to
kicyunya [14]
Interleukin-5 (IL-5). IL-5 is responsible for the recruitment and maturation of eosinophil. Eosinophils on the other hand are majorly involved in the inflammatory response in asthma- characterised by narrowing of the airways. Mepolizumab and reslizumab are, therefore, anti-IL-5
3 0
3 years ago
Read 2 more answers
Can you guys name all of the planets?<br>​
likoan [24]

Answer:

Yesssss mercury Venus earth Mars Jupiter Saturn Uranus Neptune and my baby pluto

8 0
2 years ago
Read 2 more answers
Other questions:
  • Louis Pasteur proved that all new cells come from preexisting ones. What concept did Pasteur’s experiments disprove
    14·1 answer
  • Can you answer this question for science?
    12·1 answer
  • How does respiratory system relate to respiration making ATP?
    5·1 answer
  • When crude oil is spilled in the ocean, how is the ecosystem affected? A. The supply of nutrients is increased.
    10·1 answer
  • Prior to the time of Charles Darwin, it was widely believed that all organisms appeared on Earth at the same time and remained u
    12·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which statements about a child with brown eyes must be true?<br> Choose more than one answer
    14·1 answer
  • 3. How do animals and plants depend on each other
    7·2 answers
  • he adaptive immune response is divided into two branches. The first is – immunity, in which antibodies are produced that bind to
    15·1 answer
  • Why couldn't yeast use both sugar and artificial sweetener for cell respiration?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!