1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Jet001 [13]
3 years ago
7

Fruit flies use the Z-W sex determination system True or false

Biology
2 answers:
liraira [26]3 years ago
5 0
This statement is false the answer is false
const2013 [10]3 years ago
3 0

Answer:

The answer to this question is false

You might be interested in
What is the difference between continuous and discontinuous variation?
ira [324]
Discontinuous variation <span> refer to large, conspicuous differences from the parents</span>
This is where individuals fall into a number of distinct  categories, and is based on features that cannot be measured across a complete range
continious variation refer to small, indistinct differences from the normal condition.
Milk yield in cows, for example, is determined not only by their genetic make-up but is also significantly affected by environmental factors such as pasture quality and diet, weather, and the comfort of their surroundings
6 0
3 years ago
g If I see a decreased response after administration of repeated doses of a drug I might suspect that the cell has a) Up regulat
alexandr1967 [171]

Answer:

More than one of the above

Explanation:

I strongly recommend sticking with the prescribed dosage of a drug.

A drug works by binding itself to the receptor site of a cell or tissue by non-covalent interactions.

Repeated doses of the same drug however may make the drug start behaving as an inverse agonist by blocking (instead of binding) the receptor site of the cell thus inducing a reduced response instead of an increased response to the drug.  

3 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Which types of proteins help defend the body against foreign agents like bacteria?
horrorfan [7]
Antibodies- I hope that helps :)
3 0
2 years ago
Red-green color blindness is an X-linked recessive disorder that is passed through generations and can be traced by using a pedi
emmainna [20.7K]
They all have the disease. However, carriers are generally consider those who can give the disease, but don’t have it themselves. This would make the answer Lisa and Monica as they have the recessive gene, but only have one allele, meaning they carry the gene for color blindness, but fortunately do not have it due to the dominant allele being normal.
3 0
2 years ago
Read 2 more answers
Other questions:
  • In early pregnancy, what hormone stimulates growth of the corpus luteum? human chorionic gonadotropin follicle-stimulating hormo
    9·1 answer
  • Which sentence uses the past form of the verb worry A. she worrying that the dress would not fit B.she worry that the dress will
    12·1 answer
  • This is the number of organisms of the same species that live in the same area.
    8·1 answer
  • What do most sedimentary rocks form from?​
    15·1 answer
  • Lipids are important to living things for all of the following reasons, EXCEPT that they are
    15·1 answer
  • 7
    13·1 answer
  • A species of birds entered a nonnative habitat and is now considered an invasive species. What’s the most likely effect this spe
    13·1 answer
  • What should I do when my family makes fun of me because i have Entomophobia (fear of any insect) everytime i go outside and see
    8·2 answers
  • Do most people want to have a low infant mortality rate or high infant mortality rate?
    14·1 answer
  • Is broccoli a dicot or monocot?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!