1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Molodets [167]
3 years ago
6

What is meaning of H2O and compound​

Biology
1 answer:
nataly862011 [7]3 years ago
8 0

Answer:

A chemical compound is a chemical substance consisting of two or more different chemically bonded chemical elements, with a fixed ratio determining the composition. For example, water (H2O) is a compound consisting of two hydrogen atoms bonded to an oxygen atom.

Explanation:

oo

You might be interested in
Which shows the levels of organizational hierarchy listed from least complex to most complex?
TiliK225 [7]

Answer:

That would be organism, species, and then community.

Explanation:

3 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
This diagram shows to glucose monomers being linked up for maltose sugar. The process that link the two together is
vampirchik [111]
We just learned this ! it's hydrolysis
4 0
3 years ago
here is a food chain in a meadow. Use this food chain to answer this question. Grass, Field Mouse, Corn Snake, Hawk Which is the
Aleks [24]
Plants are called producers because they make their own food. So the grass is the producer.
8 0
3 years ago
Read 2 more answers
Female mosquito is considered more harmful than male mosquito. give reason
Scrat [10]

Answer:

The female mosquitoes are the dangerous ones. They bite and draw blood. Male mosquitoes feed on flower nectar. Males have very hairy and fuzzy antennae (like a powder puff) whereas females have less hairy antennae.

3 0
3 years ago
Read 2 more answers
Other questions:
  • In which organism will pharyngeal arches be visible in the embryonic stage?
    8·1 answer
  • Which of leonardo's experiments ended disastrously?
    13·1 answer
  • Which of these words most closely matches the meaning of the word integrity in the sentence, "The ball of dough loses its struct
    8·1 answer
  • Which descriptions apply to Mendel’s pea plant experiments? Select three options.
    6·2 answers
  • In this project, you will observe an insect life cycle. You will see part of the life cycle of a grain beetle. You will begin wi
    14·1 answer
  • If a star is shown to be 33.11 trillion kilometers away, how many light years would that be?
    14·1 answer
  • 5)
    12·1 answer
  • Which are the functions of proteins?
    8·1 answer
  • 8,9,10 I need answers pls
    15·1 answer
  • Porque se dice que los receptores son especificos y tienen adaptabilidad?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!