1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maksim [4K]
3 years ago
12

What is the site of cellular respiration ?​

Biology
1 answer:
melamori03 [73]3 years ago
6 0

Answer:

Mitochondria

Explanation:

Cellular respiration occurs in your cells in an organelle called the mighty mitochondria.

You might be interested in
What bug is this?????
zlopas [31]

Answer:

It looks like a type of mosquito...m not sure

Explanation:

3 0
3 years ago
b cells are white blood cells that work by ___________________, whereas t cells attacks foreign invaders __________________.
Sloan [31]

Answer:

your answer is b cells are white blood cells that work by producing antibodies, whereas t cells attack foreign invaders directly.

Explanation:

flashcards

6 0
3 years ago
Which source is the LEAST credible for scientific information?
Margarita [4]

Answer:

D) A Survey of fellow classmates

Explanation:

This is the correct answer because an informal survey involves various answers that may or may not be accurate.  Informal surveys cannot be held as scientific fact and are, therefore, not reliable. A scientific journal is reliable because it most likely includes data from an experiment and/or research of a trusted scientist or group. The results of past experiments are very reliable because these are the results of hard work and thorough planning and research. A scientific discussion with colleagues is not very credible because it involves the sharing of opinionated information, but it is certainly more reliable that the varying answers of school-aged peers.

4 0
3 years ago
Read 2 more answers
Picture of Eukaryotic cell
alexgriva [62]
Here are two Eukaryotic cells Plant and Animal

8 0
3 years ago
1.The cell wall of a fungi is made of what?
Dmitriy789 [7]

Answer:

Chitin

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • What type of rock forms when preexisting rocks undergo changes in response to a modification of their environment, without first
    5·1 answer
  • A nurse is caring for a 5-year-old boy with end-stage acquired immunodeficiency syndrome (aids). the child confides that he is r
    15·1 answer
  • Please help me on this one thank you
    5·1 answer
  • Can you help me with question # 18
    5·1 answer
  • Luciana notices that the air in her science
    8·1 answer
  • What is the pathway of air into the body?
    12·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • How does an ATP molecule release
    7·1 answer
  • Age is a factor of
    14·2 answers
  • Rain forests supply a wide variety of resources. Some of
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!