1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sidana [21]
3 years ago
14

Compare and constraint negative and positive feedback mechanism and explain how they relate to homeostasis

Biology
1 answer:
gavmur [86]3 years ago
6 0

Explanation:

Positive feedback occurs to increase the change or output: the result of a reaction is amplified to make it occur more quickly. Negative feedback occurs to reduce the change or output: the result of a reaction is reduced to bring the system back to a stable state.

You might be interested in
What is Photosynthesis.....?!!
andreyandreev [35.5K]

Answer:

<h3>Hey!</h3>

¨Photosynthesis is a process used by plants and other organisms to convert light energy into chemical energy that, through cellular respiration, can later be released to fuel the organism's activities. ¨

<h3>Good luck! </h3><h3>Follow me plz, thx :)</h3>
6 0
3 years ago
Read 2 more answers
What animal looks like a flower and eats tiny fish?
STatiana [176]
Flower hat jellyfish, a native of the Southern Japan is the animals which look like a flower, due to the presence of pinstriped bell on it. It also has tentacles, to sting, catch and eat small fishes. It causes rashes on the humans if it stings them. 
3 0
4 years ago
Choose the correct answer.
Sloan [31]

Answer:

answer 1 shearing

answer 2 mulberry

5 0
3 years ago
Some diseases are diagnosed by looking for antibodies in the patient’s blood. Explain what a positive finding of antibodies mean
nikitadnepr [17]

Answer:

The patient has/had the disease.

Explanation:

A positive finding means that antibodies were found in the patient’s blood. Antibodies are made when you have a disease in order to help fight off the disease. Therefore, if you have antibodies for a disease, you have or had that disease (Or were vaccinated). Hope it helps :)

3 0
3 years ago
Can someone please help me with this!! ​
Tasya [4]

Answer:

YES ITS TRUE

Explanation:

6 0
3 years ago
Other questions:
  • The anicient bacteria is in what domain
    13·1 answer
  • The bones in a whale’s flipper are the same as the bones in a dog’s front leg. What does this tell you about these two organisms
    12·2 answers
  • How does the metabolism of sucrose differ from the metabolism of glucose?
    6·2 answers
  • The specifications for a product you are developing require that the cross-section area cannot be greater than 12 in2. You have
    7·1 answer
  • I changed just one thing in an experiment. What is that "one thing I changed" called?
    5·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Por qué en algunos fragmentos de ADN se mueven mas lejos que otros durante la electroforesis en gel?
    12·1 answer
  • Which of the following are amniotes? O Birds, reptiles, and amphibians O Reptiles, birds, and dogs O Cnidarians, reptiles, and m
    14·1 answer
  • Identify the locations within the human body for Hyaline, Elastic and Fibrocartilage.
    14·1 answer
  • What do decomposers leave behind after getting their energy?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!