1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kherson [118]
3 years ago
14

Which factor can potentially increase a teenager’s alcohol use?

Biology
1 answer:
Flauer [41]3 years ago
3 0

Answer:

A teenager's decision to drink alcohol can be influenced by: early introduction to alcohol. exposure to adult binge drinking or alcohol dependence. access to alcohol from parents and others.

You might be interested in
The term ____________________ describes the chemical substances that make it possible for messages to cross from the synapse of
Aloiza [94]

The term Neurotransmitter describes the chemical substances that make it possible for messages to cross from the synapse of a neuron to the target receptor.

<h3>What are Neurotransmitters?</h3>
  • Neurotransmitters are endogenous chemicals that allow neurons to communicate with each other throughout the body.
  • Chemical synaptic transmission is primarily through the release of neurotransmitters from presynaptic neural cells to postsynaptic receptors.
  • There are a number of neurotransmitters used by the body for different functions, including acetylcholine, norepinephrine, glutamate, GABA, glycine, dopamine, and serotonin.
  • Glutamate is the principal excitatory neurotransmitter used in the brain.
  • GABA and Glycine serve as the major inhibitory neurotransmitters.

To learn more about Neurotransmitters,

brainly.com/question/1980965

#SPJ4

5 0
1 year ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
2 years ago
Read 2 more answers
Which of the following is a benefit of recreation activities?
9966 [12]

Answer:

C Noise pollution

Explanation:

because organisms create noise.

3 0
2 years ago
Read 2 more answers
The first organ that sperm pass through is the __________. the first organ that sperm pass through is the __________. epididymis
mariarad [96]
<span>During ejaculation, the sperm is sent out from the epididymis into the deferent duct which then travels up the spermatic chord into the pelvic cavity. The first organ that sperm pass through is the epididymis ejaculatory duct . During this time rhythmic movements propel the sperm forward.</span>
8 0
2 years ago
Provide evidence that ancient Antarctica was situated in a different location from its location today?
gogolik [260]
Alfred has been in warm area your answer
6 0
3 years ago
Other questions:
  • If something exhibits all of the characters of life , it is considered to be ______
    8·2 answers
  • Is there one place on earth where we can see the complete geologic column? How and why?
    15·1 answer
  • A firefighter wakes up in the middle of the night to the sound of an alarm. it is likely that her _____ have released epinephrin
    6·1 answer
  • a species of rodent can either have brown fur or white fur. Brown fur is recessive and white fur is dominant. what would cause t
    8·2 answers
  • Pick the group of elements with the most common characteristics
    13·1 answer
  • Membrane-bounded vesicles that contain enzymes for oxidizing small organic molecules with the formation of hydrogen peroxide are
    13·1 answer
  • In flies, small wings (s) is recessive to normal wings (S). If a cross between two flies produces 8 small wing offspring and 26
    12·1 answer
  • Do sponges have cells
    11·2 answers
  • What event starts the Krebs Cycle?
    7·2 answers
  • Heat is a form of engery.justify.​
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!