1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
JulijaS [17]
3 years ago
5

Which book asserted that due to the expanding human population, the ecosystem will collapse by the middle of the twenty-first ce

ntury?
Biology
1 answer:
vlada-n [284]3 years ago
6 0

Answer: Hello There!............

Dennis Meadow's, the limits to growth, asserted that due to the expanding human population, the ecosystem will collapse by the middle of the twenty-first century.

Explanation:

Mark me brainest please. Hope this helps. Anna ♥

You might be interested in
A scoop of ice cream is placed on top of a warm piece of pie in a bowl.
Lisa [10]

Answer:

b. The overall amount of energy in the bowl will neither increase nor decrease.

c. The ice cream will increase in energy.

Explanation:

b. The total amount of energy in the container will not increase or decrease. Since the energy is transferred from one element to another, the energy that dissipates is negligible.

In this case the energy of the pie is transferred to the ice cream, melting it.

c. The ice cream will increase in energy. As the heat is transferred from the pie to the ice cream. the movement between the particles of the ice cream increases, increasing its kinetic energy

5 0
3 years ago
Read 2 more answers
What is the correct order of events in the sliding filament theory of muscle contraction? 1. Myosin head binds to actin 2. Calci
valkas [14]

Answer:

The correct order is: 6) Sarcoplasmic reticulum releases calcium ions, 2) Calcium ions bind to troponin, 5) Tropomyosin moves to expose active sites of actin, 4) ATP is split into ADP and P, 1) Myosin head binds to actin, 7) ADP and P released from myosin, 3) Myosin cross-bridges bend, pulling actin toward center of sarcomere.

Explanation:

The ability to contract is an important property of the muscle cells and is fundamental to animals because muscles not only make locomotion possible but are also responsible for the correct functioning of organs (including the heart).

The mechanism behind muscle contraction is the sliding of filaments in a structure called sarcomere, which mostly involves the presence of actin and myosin filaments.

For muscle contraction to happen, there needs to be a <u>stimulus coming from the nerve that innervates said muscle</u>. This stimulus generates the release of <u>calcium ions</u> that will bind to a protein called troponin and will lead to the exposure of the active site of actin so it can bind to the myosin head. <u>This process requires ATP</u>.

7 0
3 years ago
Which substance is the focal point of climate models such as sea ice, heat and salinity exchange, and phase changes?
Anastasy [175]
Carbon dioxide should be the answer considering its a huge focal point in our climate today and how it affects it.
4 0
2 years ago
Big cats like tigers and other carnivores are often the top predators in an ecosystem. To which trophic level do they most likel
Lesechka [4]

Answer:

tertiary consumers because they are also the one who eats secondary consumers.

3 0
2 years ago
Read 2 more answers
What stage of meiosis is seen here:
Goryan [66]

Answer:

It looks like Telephase 1

8 0
3 years ago
Other questions:
  • What property makes water molecules stick together?
    9·2 answers
  • Which of the following biomolecules typically contains both nitrogen and phosphorus?
    11·1 answer
  • 1-5 fill in the blanks
    12·2 answers
  • Esther feels an itch simultaneously deep in her ears and right above her soft palate. If
    13·1 answer
  • What organ provides the major site for lipoprotein formation from exogenously derived lipids?
    9·1 answer
  • A report that indicates the average income of all citizens in Washington, D.C. is most likely an example of:
    14·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • At three minutes of all-out high-intensity exercise, ________ of the ATP is derived from aerobic sources.
    5·1 answer
  • Which biomes have the most fertile soil and can sustain a very diverse ecosystem?.
    10·1 answer
  • Which of these is produced during photosynthesis
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!