1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
anastassius [24]
3 years ago
11

List the 3 rules you must follow when WRITING a scientific name.

Biology
1 answer:
ehidna [41]3 years ago
5 0

Answer:

The binomial name consists of a genus name and specific epithet. The scientific names of species are italicized. The genus name is always capitalized and is written first; the specific epithet follows the genus name and is not capitalized. There is no exception to this.

You might be interested in
The earth is composed of three different chemical layers core mantle and crust the formation of these layers was from a process
pickupchik [31]

incompatible elements


7 0
3 years ago
How do igneous rocks provide evidence about the Earth?
Serga [27]

Answer:

pls mark brainlest The chemical composition of an igneous rock tells us about the origin of the magma, beginning with which type of rock melted within the earth to form the magma in the first place, and how deep in the earth the melting occurred. Once magma has formed inside the earth, its composition may be modified.

6 0
2 years ago
Read 2 more answers
If both a mother and a father carry a dominant gene for dark eyes and a recessive gene for light eyes (Bb), what is the likeliho
inessss [21]
75%    (3/4)

there would be BB, Bb, Bb and bb

BB and Bb are the only ones that is dominant since bb is recessive.
3 0
3 years ago
Read 2 more answers
Which is the DNA tehory? How do we know the DNA contains genetic information?
ValentinkaMS [17]

DNA is made up of molecules called nucleotides. Each nucleotide contains a phosphate group, a sugar group and a nitrogen base. The four types of nitrogen bases are adenine (A), thymine (T), guanine (G) and cytosine (C). The order of these bases is what determines DNA's instructions, or genetic code. Human DNA has around 3 billion bases, and more than 99 percent of those bases are the same in all people. DNA sequencing theory is the broad body of work that attempts to lay analytical foundations for determining the order of specific nucleotides in a sequence of DNA

6 0
3 years ago
What is the largest division of geologic time
densk [106]

Answer:

eons

Explanation:

these divisions contain anywhere from millions to billions of years

8 0
3 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • While performing an experiment at home, Emma adds lemon juice to a soap solution. How will this affect the pH of the soap soluti
    13·1 answer
  • The scientist who in 1758 created a system that is the basis of the modern system of classification of organisms is __________.
    15·1 answer
  • How do multicellular organisms grow?
    10·2 answers
  • Describe a living system that is not an organ system or an ecosystem.
    5·1 answer
  • 2. Where does most of the pollution come from in marine biomes?
    7·1 answer
  • Which of the following is not a primary difference between mitosis and meiosis?
    8·2 answers
  • What should be done after listing the options when making good health decisions? ASAP FOR A GRADE ANSWER: Identify the consequen
    7·2 answers
  • A scientist is trying to decide whether an organism is unicellular or multicellular. Which information would help the scientist
    15·1 answer
  • Question 5 of 30
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!