In order to contract, muscle fibers need

Biology

2 answers:

solmaris [256]3 years ago

8 0

Answer:

When the muscle starts to contract and needs energy, creatine phosphate transfers its phosphate back to ADP to form ATP and creatine. This reaction is catalyzed by the enzyme creatine kinase and occurs very quickly; thus, creatine phosphate-derived ATP powers the first few seconds of muscle contraction.

Harrizon [31]3 years ago

6 0

C. Energy

In order for anything to move, it will require energy

You might be interested in

Why is cells important?

iogann1982 [59]

Explanation:

as cell are thebasic structure of all living being.

7 0

3 years ago

Which of the following statements is true? 1. If you don't know a law exists, it's ok to not follow it. 2. People in an experime

Fudgin [204]

Answer:

Explanation:

6 0

3 years ago

A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th

IgorC [24]

Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations

5 0

3 years ago

Why are autosomal genetic disorders usually recessive

Sever21 [200]

<span>Autosomal recessive is one of several ways that a trait, disorder, or disease can be passed down through families. An autosomal recessive disorder means two copies of an abnormal gene must be present in order for the disease or trait to develop</span>

3 0

3 years ago

What are the causes of the attractions and repulsions between molecules of water

Inessa05 [86]

The causes of the attractions and repulsion between molecules of water is that the oxygen and hydrogen atoms share electrons in bonds but its not equal. I hope this is the answer you are looking for! :)

8 0

3 years ago