1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew-mc [135]
3 years ago
6

Why environmental health is a community issue​

Biology
1 answer:
Morgarella [4.7K]3 years ago
8 0

Answer:

Explanation:

because the environment reflects the people if the environment is sickly then 9 times out of 10 the people are sickly

You might be interested in
The graph shows the amount of pollution removed by trees during October, the Trees were able to remove the greatest about of___.
Minchanka [31]
I think the answer is ozone i hope i am right and hope this helps

5 0
3 years ago
HELP!!!! answer quickly
Maksim231197 [3]

Answer:

Movement of free water molecules from an area of low concentration to an area of higher concentration

Explanation:

4 0
3 years ago
Mention about the four events of a occur during a binary fission in amoeba
Dafna1 [17]

Answer

The 4 events that occur during amoeba are:-

  • It sees the food particle.Then by pseudopodia (the finger like projections from amoeba) traps the food particle.
  • The finger-like extensions of the cell surface fuse over the food particle forming a food vacuole.
  • Inside the food vacuole, complex foods are broken down into simpler ones which then diffuse into the cytoplasm.
  • The remaining undigested material is moved to the surface of the cell and thrown out. [Egestion].

7 0
3 years ago
What phase is Homologous chromosome paired.
kumpel [21]

In metaphase I of meiosis I, the pairs of homologous chromosomes, also known as bivalents or tetrads, line up in a random order along the metaphase plate. The random orientation is another way for cells to introduce genetic variation.

4 0
3 years ago
Help will give brainlist
Fiesta28 [93]

Answer:

Its B or C but im pretty sure its C

3 0
2 years ago
Read 2 more answers
Other questions:
  • Now that you have reviewed both immunity and the spread of disease, write an investigative question that you would like to answe
    15·2 answers
  • A woman at 22 weeks' gestation has right upper quadrant pain radiating to her back. she rates the pain as 9 on a scale of 1 to 1
    13·1 answer
  • I'm writing a 5 para for science ab skin cancer. i have a lot of info but i am having trouble wording it. how should i paraphras
    7·1 answer
  • What are the harmful effects of pizza?
    14·1 answer
  • G-protein-coupled receptor kinase specificity for arrestin recruitment to the adrenergic receptor revealed by
    7·1 answer
  • A three letter sequence of MRNA that encodes for a specific amino acid is called a/an. A series of these links specific amino ac
    12·1 answer
  • Why is carbon important
    14·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • What causes oxygen to diffuse from the lungs into the capillaries?
    7·1 answer
  • In three to five sentences explain how resource scarcity, competition, and the survival of organisms are connected. (4 points)
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!