1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ostrovityanka [42]
3 years ago
14

Marshes are generally flooded for most of the year. Which types of plant live here?

Biology
2 answers:
quester [9]3 years ago
5 0

Answer:

A, mosses

Explanation:

Most cant die in water and many live in water (ex. Java moss)

just olya [345]3 years ago
4 0
Grasses and non-woody plants like cattails
You might be interested in
The difference in lipid and protein composition between the membranes of the endomembrane system is largely determined by the __
Maksim231197 [3]

The options to the given are:

A) The physical separation of most membranes from each other.

B) the transportation of membrane lipids among the endomembrane system by small  membrane vesicles.

C) The function of the Golgi apparatus in sorting and directing membrane components.

D) The modification of the membrane components once they reach their final  destination.

E) the synthesis of different lipids and proteins in each of the organelles of the  endomembrane system.

Answer: Option C

Explanation:

The difference in the lipids and proteins composition of the different membrane is different.

Different endomembrane system have different composition of the lipids and proteins in its membrane according to the function of he membrane.

The sorting and direction of the proteins is the function of golgi body. So, it is by the action of the golgi body that the distribution and the sorting of the protein molecules are done.

The protein once formed need to be modified and sorted before being functional into the organelles.

6 0
3 years ago
In which part of the nephron are sodium and chloride ions actively reabsorbed?
Eva8 [605]
The part of the nephron that In which part of the nephron are sodium and chloride ions are actively reabsorbed is the Henle's loop. It <span>is the portion of a </span>nephron<span> that leads from the </span>proximal convoluted tubule<span> to the </span>distal convoluted tubule<span>.</span> It's main function is to make a concentration gradient in the medulla of the kidney. 
3 0
3 years ago
The consistent reduction in fitness (survival, reproduction, etc) in a population due to widespread non-random mating is called
igomit [66]

Answer:

Natural selection

Explanation:

Natural selection occurs when one allele (or combination of alleles of different genes) makes an organism more or less fit, that it is able to survive and reproduce in a given environment. If an allele reduces fitness, its frequency will tend to drop from one generation to the next.

4 0
3 years ago
Taxonomy is an organizing science used in _____.
Kruka [31]
Ok biology i think maybe
5 0
3 years ago
Read 2 more answers
The heart damage associated with Lyme disease is
alexandr402 [8]

ANSWER:

The heart damage associated with Lyme disease is Lyme carditis.

~batmans wife

6 0
3 years ago
Other questions:
  • PLEASE HELP 10 POINTS!!!!
    5·2 answers
  • Why is it important for cells of multicellular organisms to undergo mitosis
    11·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • ANSWER QUICKLY PLEASEEE. DONT ANSWER UNLESS YOU’RE REALLY GOOD AT SCIENCE.
    12·2 answers
  • What are the two ways a hypothesis can be solved?
    8·1 answer
  • What term relates to connection of skin to underlying muscles?
    6·1 answer
  • Which of the following skin defenses and its mechanism is mismatched? Multiple Choice Sebum; lipid hydrolysis leads to toxic by-
    9·1 answer
  • A recovery heart rate for a person who is 25 years of age after 5 minutes of working out is about:
    6·2 answers
  • Why is Louis Pasteur considered the national hero of France?
    13·1 answer
  • Складіть ланцюги живлення, починаючи з продуцентів і закінчуючи редуцентами:
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!