Glucose and amino acids are polar hydrophilic in nature. Hence, both molecules will be repelled by the hydrophic core of the phospholipid bilayer, made up of non-polar fatty acid tails. For such molecules to pass through the phospholipid bilayer, it requires a carrier transmembrane protein to provide a hydrophilic channel for specific polar molecules to enter.
Endocytosis is uptake of liquid or solid from extracellular matrix (usually large in size or large in volume)
Exocytosis is the release of substances out of cells. (usually hormones/chemicals/proteins)
Hence, ans is faicliated diffusion
Answer:
ATGGCCTACGGTCTAGTTTAG
Explanation:
A=T
C=G
G=C
T=A
This is the key to finding a complementary <u>DNA strand</u>.
Answer:
Pulmonary fibrosis is a disease that affects the lungs. The lung tissue becomes damaged and scarred which causes it to be thickened and stiff.
The condition pulmonary fibrosis is caused by the replacement of elastic fibers in the lung with inelastic collagen fibers. This decreases the lungs’ ability to stretch outwards.
Pulmonary fibrosis however mainly affects inspiration because the lungs cannot stretch to increase volume while during expiration stretching of the tissues doesn’t happen so it doesn’t affect the process.
I believe It is Solid waste either that or hazardous
-270 degrees Fahrenheit
62 confirmed moons... A few others are still pending
Has a radius of 36,184 miles. Has a mass 95.16 times the mass of Earth.
No, it is unlikely there will be any life on Saturn, due to its extremely cold temperatures.
Saturn comes from the Roman name of Cronus. It is large enough to contain more than 760 Earths. Winds in Saturn's upper atmosphere can reach up to 1100 mph!