1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Degger [83]
3 years ago
8

"Meghan was driving home when she heard a tire explode on the car right next to her. As a result, her heart started pounding and

she began to shake, and she sped up to move as far from the sound as possible. Based on this information, which nervous system was activated when Meghan first heard the explosion?"
Biology
1 answer:
Aliun [14]3 years ago
8 0

Answer:

Sympathetic nervous system

Explanation:

The sympathetic nervous system of the autonomic division prepares the body for stress or emergency conditions by generating the “fight-or-flight” responses. The sympathetic nervous system triggers the release of stress hormones from the adrenal medulla to generate the set of physiological responses.

There is dilation of the pupil, and an increased rate of heartbeat and increased blood pressure. Other responses include dilation of airways and dilation of blood vessels that supply blood to skeletal muscles, heart muscles, liver, etc. Under the given emergency condition, the sympathetic nervous system of Meghan was activated to generate the fight or flight response.

You might be interested in
A carbon atom can bond with other atoms in a variety of ways. Wich set of bonds would a typical carbon atom in a compound
notsponge [240]

Answer:

A carbon atom can form up to four covalent bonds as one carbon atom has four valence electrons (in outermost shell). It is a fact that the number of valence electrons in a atom determines the number of covalent bonds it will form. Thus, each electron in carbon atom is used to form four covalent bonds with various four atoms.

Explanation:

A bond between a carbon and hydrogen atom is a non-polar covalent bond. The non-polar covalent bond are the bonds between two atoms which share equal number of electron(s) with each other. Example: as in case of methane, where one carbon atom shares its 4 outer valence electrons with four hydrogens by sharing equal number of electron.

In contrast, polar covalant bond are the bonds between two atoms which share unequal number of electron(s) with each other. Thus these bonds are partially ionic.

6 0
3 years ago
What are four elements that make up over 95% of the body in most organisms
natima [27]
Oxygen<span>, </span>sulfur<span>, </span>nitrogen<span>, and </span>hydrogen<span>.

</span>
5 0
3 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
How is breathing related to cellular respiration
Minchanka [31]
When you breath in you breath in oxygen, which comes from plants, when you breath out, you breath out carbon dioxide, which is what plants breath.
7 0
2 years ago
Read 2 more answers
Air and water quality, climate, erosion, disease transmission, pest proliferation, and pollination are all examples of which cat
Gennadij [26K]

Answer:

Regulating

Explanation:

According to Millennium Ecosystem Assessment, there are four major categories of ecosystem services. These services include:

1. Provisioning

2. Regulating

3. Supporting

4. Cultural

The Regulating category is the category that consists of Air and water quality - Purification, climate, erosion, disease transmission, and pest proliferation - Biological control, and pollination.

The ecosystem services are services or functions rendered by the natural environment that ensure the environment is sustainable and healthy for human use.

8 0
3 years ago
Other questions:
  • Unlike animal cells, plant cells have cell walls that make them rigid. Which organelle, other than the cell wall, also plays a v
    9·1 answer
  • Which of the following professionals could help a large city that needs a means of providing safe drinking water to all of its r
    13·1 answer
  • Which of the following is used up during cellular respiration
    15·1 answer
  • The arctic fox is different from the brown fox. The color of the arctic fox’s fur changes to brown during the summer. The fur re
    5·2 answers
  • AWNSER ASAP PLEASE!!!
    12·1 answer
  • During this phase of cell division chromosomes settle at opposite ends and
    15·1 answer
  • A chemical bond formed by transfer of electrons
    6·1 answer
  • Why do certain bacteria become endospores?
    7·1 answer
  • How does folding dough help it to rise
    10·1 answer
  • How do plants photosynthesize in winter? When they shed their leaves.​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!