1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paul [167]
3 years ago
11

Is Isoheptenes hazardous when wet

Chemistry
2 answers:
Oksanka [162]3 years ago
7 0
Yes because they undergo a chemical reaction with water.
Dmitry_Shevchenko [17]3 years ago
3 0

Answer:

yes it is dangerous

Explanation:

Water reactive substances are dangerous when wet because they undergo a chemical reaction with water.

You might be interested in
Explain vapour pressure and surface tension What is plasma
worty [1.4K]

Vapor Pressure: Measures how a substance is likey to evaporate

Surface Tension: is the attraction between liquid molecules.

Plasma: is an organic and inorganic substance that is typically found in blood

5 0
3 years ago
The critical point of carbon dioxide is 304 k and 73 atm. under which conditions is carbon dioxide a liquid? i. 303 k and 73 atm
Sergeeva-Olga [200]
Answer is: a) I only.
Above critical temperature of CO₂, a gas cannot be liquefied no matter how much pressure is applied. Temperature and pressure above its critical point is called supercritical fluid and this is <span>intermediate between gaseous and liquid states.</span>
7 0
3 years ago
Differences in air pressure drive the global wind system on earth. Which term describes polar winds that blow from east to west?
marshall27 [118]

Answer: Polar Easterlies

Explanation: Winds flow from high pressure areas to low pressure areas. They originate in the north and south pole creating high pressure zones which generates an outflow. This outflow is then directed from east to west and hence the term used to describe these winds is Polar Easterlies.

6 0
3 years ago
In which type of climate would the soil most likely be well developed and have lots of organic matter?
sleet_krkn [62]
I suppose it would be forest because in order to have organic matter the soil needs to be rich and fertile,therefore it is forest.
3 0
3 years ago
The compound MgF is an example of a(n)
Delvig [45]
MgF is an ionic compound because it's bond is between a metal and a non-metal
7 0
3 years ago
Other questions:
  • Which of the following organelles is best compared to a post office? 1.Endoplasmic reticulum 2.Golgi apparatus 3. Nucleus 4. Cel
    14·1 answer
  • In the electrolysis of molten fei3, which product forms at the cathode?
    6·1 answer
  • Which type of radiation particle, emitted from a nuclear reaction, is most similar to a helium nucleus?
    9·2 answers
  • The reaction ch4 (g) + 2 o2 (g) ? co2 (g) + 2 h2o (g) is: the reaction ch4 (g) + 2 o2 (g) co2 (g) + 2 h2o (g) is: an exothermic
    10·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • What type of chemical reaction might be confused with the synthesis reaction in part 1, and how can you distinguish these two re
    13·1 answer
  • If a decrease in temperature accompanies a reaction, what occurred?
    8·1 answer
  • What term do you use to describe a solutio that has a lower concentration compared to another solution?
    12·1 answer
  • What will happen to the pH of a solution when the [H+] is increased?
    12·1 answer
  • Help me figure out these I’ll mark u brainliest <br> It’s science
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!