Answer:
The correct answer is beginning of cell mitosis.
Explanation:
Cyclins are cell cycle regulatory protein which regulates the catalytic activity of cyclin dependent protein kinase or CDK.From the name cyclin dependent protein kinase it can be concluded that CDK helps in the phosphorylation of key proteins of cell cycle.
The combination of cyclin with CDK helps in the progression of cell from one phase to another.
Such as cyclin A CDK 2 helps also called G1 cyclin CDK helps in progression of cell from G1 to S phase whereas Cyclin B CDK 1 or M cyclin CDK helps in beginning of mitosis phase or M phase of the regulated cell.
Answer:
the answer to this question is B i believe
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
C X-inactivation "switches off" one of the X chromosomes.
Explanation:
i believe the answer is B, Salt accumulates near the surface of the soil.
