1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnom [1K]
3 years ago
10

If something doesn't fulfill all of the

Biology
2 answers:
Evgesh-ka [11]3 years ago
5 0
C or D I’m not sure
Vinil7 [7]3 years ago
3 0

Answer:

C. Viruses

Explanation:

Viruses lack the properties of living things. They have no energy metabolism, they do not grow, they produce no waste products, and they do not respond to stimuli. They also don't reproduce independently but must replicate by invading living cells.

You might be interested in
For survival a hummingbird uses a considerable amount of energy . This energy most directly results from the life activity of ?
insens350 [35]

This energy most directly results from the life activity of  respiration.

The hummingbirds have very high energy expenditure (have the highest oxygen requirements of all vertebrae) with a fast heart rate, very fast wing beats and sustained hovering. So the hummingbird is nearly always on the edge of starvation, needing to take in more nectar than its body weight each day.

The respiratory system of these birds is highly adapted for the high oxygen needs. So, the muscles of the hummingbird cause pressure changes within the air sacs. As a result, more oxygen can enter the respiratory system. Also, they have the highest density of red blood cells which allows them to rise heart beat to around 500 breaths per minute during flight.


4 0
4 years ago
Read 2 more answers
An atom is the smallest complete part of a(n) __________ that still has all the original properties of this substance.
Mekhanik [1.2K]
C. Element
it's the answer to your question
4 0
3 years ago
Read 2 more answers
The Earth's seasons affect only the way plants grow and change.
Black_prince [1.1K]

Answer:

yes but it can also affect humans like tornadoes destroying homes?

6 0
3 years ago
All of these are sources of acid EXCEPT (Select one):
Olegator [25]

Answer:

c) the incomplete oxidation of fatty acids

Explanation:

7 0
4 years ago
In this modern age of science, which of the following shows the most promise in producing crops with a higher yield? )
Nastasia [14]

Answer:

In this modern age of science. Which of the following shows the most promise in production crops with a higher yield

A genetic engineering of crops plants

4 0
3 years ago
Other questions:
  • Which of the following best explains why a variety of monomers are needed to produce the complex molecules necessary for life? D
    9·1 answer
  • ​(Related to Checkpoint​ 18.2) ​ (Calculating the cash conversion​ cycle) Network Solutions just introduced a​ new, fully automa
    15·1 answer
  • _____ assumes that intellectual disability is a consequence of a disease process or biological defect.
    11·1 answer
  • : Which of the following is not a sign of sepsis? Which of the following is not a sign of sepsis? increased white blood cell cou
    14·1 answer
  • Gravitational potential energy is related to?
    5·1 answer
  • A change in a person’s environment that is received by their nervous system
    8·1 answer
  • Evolution is a long and arduous process that has created humans with many different traits. Can you think of some genetic mutati
    10·1 answer
  • What does the process of
    13·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • innate immune suppression by sars-cov-2 mrna vaccinations: the role of g-quadruplexes, exosomes, and micrornas
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!