Answer:
Am I supposed to tell you if it's right or wrong? or what...??
Explanation:
Answer: Glands in your stomach lining make stomach acid and enzymes that break down food. Muscles of your stomach mix the food with these digestive juices. Your pancreas makes a digestive juice that has enzymes that break down carbohydrates, fats, and proteins, along with your liver that makes a digestive juice called bile, which helps digest fats and some vitamins. The pancreas delivers the digestive juice to the small intestine through small tubes called ducts. Bacteria in your small intestine make some of the enzymes you need to digest carbohydrates. It also absorbs water with other nutrients. Bacteria in your large intestine help break down remaining nutrients and make vitamin K NIH external link. Waste products of digestion, including parts of food that are still too large, become stool.
Explanation:
Mouth. The digestive process starts in your mouth when you chew. Your salivary glands make saliva, a digestive juice, which moistens food so it moves more easily through your esophagus into your stomach. Saliva also has an enzyme that begins to break down starches in your food.
The correct answer is true
It should be
AGATACCATGGTTACCCGGTTCCA
Science and art are two areas that can contain genius, so these two factors were added to the construction of the Huntingtin "song", in order to answer this question we need to know that ....
<h3>Huntingtin "song"</h3>
A group of researchers explored this question in a fascinating way. Rie Takahashi, Frank Pettit, and Jefrey Miller at UCLA created a program that created music from a DNA sequence (a gene) based on the protein that that gene encodes. Te program transcribed and then translated a gene, producing a protein sequence.
<h3>Huntingtin gene</h3>
The huntingtin gene is the DNA sequence associated with Huntington disease, a very serious, inherited neurological disorder.
With this information, we can say that what is unusual about the Huntingtin "song" is that the sound transcribed by the gene that contains Huntingtin disease will be a different song than that of people with DNA without this disease.
Learn more about DNA in brainly.com/question/264225?referrer=searchResults
