1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vera_Pavlovna [14]
3 years ago
8

What is a chromosome ?

Biology
2 answers:
Katena32 [7]3 years ago
5 0

Answer:

long DNA

Explanation:

A chromosome is a long DNA molecule with part or all of the genetic material of an organism. Most eukaryotic chromosomes include packaging proteins called histones which, aided by chaperone proteins, bind to and condense the DNA molecule to maintain its integrity.

yKpoI14uk [10]3 years ago
4 0

Answer:

A chromosome is a long DNA molecule with part or all of the genetic material of an organism. Explanation: Your body is made up of billions of cells, which are too small to see without a strong microscope. Inside most of those cells are chromosomes, which are thread-like strands that contain hundreds, or even thousands, of genes. Genes determine physical traits, such as the color of your eyes. hope this helped <3

You might be interested in
From which one of these items will water evaporate at a different rate?
Irina-Kira [14]
From which one of these items will water evaporate at a different rate?a. Factory
8 0
3 years ago
Read 2 more answers
Below is a listing of nephron components and associated structures: 1. descending limb of loop of Henle 2. Bowman's capsule 3. c
Andrew [12]

Answer:

2. Bowman's capsule

6. proximal tubule

1. descending limb of loop of Henle

4. ascending limb of loop of Henle

5. distal tubule

3. collecting tubule

Explanation:

There are two main components of a nephron-  

a) Renal Tubule

b) Renal Corpuscle

Renal Tubule –  

The renal tubule emerges from the glomerulus and consists of three sub parts  

a) Proximal Convoluted Tubule (PCT)

b) Henle’s Loop – has descending and an ascending limb

c) Distal Convoluted Tubule (DCT) – last part of nephron

Renal Corpuscle- consists of a glomerulus surrounded by a Bowman’s capsule

So the correct order is as follows  

2. Bowman's capsule

6. proximal tubule

1. descending limb of loop of Henle

4. ascending limb of loop of Henle

5. distal tubule

3. collecting tubule

8 0
4 years ago
Read 2 more answers
At the END of the experiment, a. side A is hypertonic to side B. b. side A is hypotonic to side B. c. side A is isotonic to side
SpyIntel [72]

Answer:

side A is hypotonic to side B.

Explanation:

7 0
3 years ago
Which part of the body carries out the function of copying DNA? There’s two options, heart or cells?
scoray [572]

Answer:

cells

Explanation:

That is one of many of the cells functions.

8 0
3 years ago
Plz help me well mark brainliest if correct!!....
SSSSS [86.1K]

Answer:

The answer is D (last one)

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • A scientist finds what she thinks is a new species of rodent on a small Pacific island. However, some similar-looking rodents in
    9·2 answers
  • 50 POINTS!!! PLZ HELP
    15·2 answers
  • How to use punnet squares to caclulate ratios?
    8·1 answer
  • What takes place in the mitochondria matrix?
    12·1 answer
  • Which is not a requirement for natural selection to occur?
    7·1 answer
  • Which is not one of the main areas of earth science
    9·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Which animal has blue blood ??​
    11·2 answers
  • ?
    9·1 answer
  • Question 6: Describe a process scientists could use to test your conclusion from Question 5 in order to determine the exact age
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!