1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
brilliants [131]
3 years ago
7

Which one(s) contribute the most to the mass of a plant? I. Soil II. Carbon III.Water A) I only B) II only C) I and III only D)

II and III only
Biology
2 answers:
allochka39001 [22]3 years ago
5 0
<span>D) II and III only is what i would put</span>
Zolol [24]3 years ago
5 0

Answer:  D) II and III only

The mass of the plant is primarily carbon. The carbon comes from the carbon dioxide absorbed by the plant from the atmosphere. The process of photosynthesis utilizes the light energy from the sun to be converted into chemical energy in the form of carbohydrates, which is a source of carbon. The water is absorbed by the plants through the roots. The water makes up 75% of the entire plant structure. It is a necessary ingredient of each plant cell, it is a solvent which allows the dissolution of plant nutrients, hormones and toxins. Water keeps the plants in the erect state, in the absence of water wilting can occur and plant may die.

You might be interested in
Put the following in the correct order from smallest (#1) to largest (9)
kobusy [5.1K]

Answer:

atom

Explanation:

3 0
3 years ago
The amount of goods and services produced by an economy divided by the amount of resources used to make those goods and services
Alisiya [41]
<span>The amount of goods and services produced by an economy divided by the amount of resources used to make those goods and services, measures economic D. productivity.</span>
4 0
3 years ago
Why does incomplete dominance not support the blending theory of inheritance?
Nookie1986 [14]
Incomplete dominance can happen in flowers such as snap dragons where a red flower plant and a white flower plant have an offspring that is neither red nor white but is a mix so in this case it would be pink. It does not support the blending theory as it does not get its colour from the dominant plant in this case but from both.
5 0
3 years ago
What’s the difference between alleles that are codominant and those that are incompletely dominant?
gulaghasi [49]

Answer:

Codominant- when both are expressed like in flower red and white are codominant so they mixes to get a pinks flower.

Incomplete Dominants- is when a where cow and brown cow mix the offspring are brown with white patches

5 0
3 years ago
Which two molecules generated by the Krebs cycle pass their high-energy electrons to the electron transport
Sidana [21]

<u>Answer</u>:

The two molecules generated by the Krebs cycle that pass their high-energy electrons to the electron transport are NADH and  FADH2

<u>Explanation:</u>

The kreb's cycle gives NADH and also the another hydrogen carrier which is termed as FADH2. During the process of the electron transport chain, one NADH gives rise to electrons and also the hydrogen ions, which has enough potential energy that can convert and produce 3 ATP molecules. Again in the electron transport chain the NADH and the FADH2 undergoes oxidation and releases energy in the form of the ATP. The process of generation of the ATP in the electron transport chain(ETC)  is also referred as the chemiosmotic phosphorolation.

6 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Where is the cardiovascular control center in the brain?
    15·1 answer
  • Describe the procedure of hypophysation​
    11·1 answer
  • Travels faster through a liquid than through a solid
    5·2 answers
  • If you take a dna sample from a newborn, would it match a dna sample from when the same person is 80?
    6·1 answer
  • What is meant by ethical issues
    7·1 answer
  • What are 4 characteristics of metals?
    5·1 answer
  • 1. A stream dries up. Did the water in the stream:
    6·1 answer
  • Why is earths interior layered?
    11·1 answer
  • ANYONE KNOW THIS?? PLZ LMK ASAP!!
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!