1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
galben [10]
3 years ago
14

In the phospholipid, the polar head is considered what type of structure? 1.hydrophobic 2.insoluble 3.hydrophilic​

Biology
1 answer:
Mumz [18]3 years ago
7 0
Your answer is hydrophilic, The phosphate group is the negatively-charged polar head, which is hydrophilic. The fatty acid chains are the uncharged, nonpolar tails, which are hydrophobic.

Hope this helps!
You might be interested in
Which of the following adaptations would help a tree-dwelling nocturnal scavenger survive in its environment?
yaroslaw [1]
Night vision because the creature will be able to hunt food in the night, having enhanced eye sight. To continue, light colored fur would make the creature stand out taking away cover and the other answers have no benefit to the scavenger.
6 0
3 years ago
Read 2 more answers
Explain what it means when a molecule is referred to as being hydrophobic or hydrophilic. Give an example.
Fynjy0 [20]
Hydrophobic is when it cannot dissolve in water and hydrophilic is when it can. an example is a phospholipid in the cell membrane- the the tails are hydrophobic and the heads are hydrophilic.
5 0
3 years ago
What happened when the Colorado Plateau rose???
gayaneshka [121]
It started to mold what is now the grand canyons.
4 0
4 years ago
Is sand alive according to the characteristics of life? Why or why not?
Vinvika [58]
No because it does not use energy, reproduce, have a metabolism, breathe, or maintain homeostasis and its not made up of cells.
8 0
3 years ago
What mechanism did darwin propose to supply the changes needed for evolution
IRISSAK [1]

Each organ of the body produces pangenes which travel through the blood to the reproduction organs to be given to offspring. This is of course false as proven by scientists.

3 0
4 years ago
Other questions:
  • If having an XX genotype means you will have purple eyes, what is the probability that a child from these parents will have purp
    6·1 answer
  • Where do electrons come from
    8·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which is the best physical description of a gene
    7·2 answers
  • Cardiac muscle fibers function to:
    8·1 answer
  • Rosa fills a graduated cylinder with 100 milliliters of Liquid X. She fills another graduated cylinder with 100 milliliters of L
    11·2 answers
  • when oxygen availability drops certain cells in the kidney respond by producing a hormone called which in turn stimuate
    15·1 answer
  • Question 7
    15·1 answer
  • Is the adaptation physical or behavioral. Humpback whales migrate north from Antarctica to breed in warmer water.
    12·1 answer
  • We know that the pressure of water increases with depth. Then, which of the following shows the most possible shape of a dam?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!