1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stolb23 [73]
3 years ago
14

How do the structures of the alveoli and capillaries support the function of gas exchange?

Biology
1 answer:
NISA [10]3 years ago
7 0
I think c is the correct answer
You might be interested in
Extracts of the rosy periwinkle, catharus roseus, have provided medicine with vincristine and vinblastine, drugs now available f
viva [34]
The answer is preserving biodiversity. It can be well-defined as the biological changeability among all living plants and animals of the earth as an outcome of the evolution procedures and contains of three levels of biological diversity which are genetic diversity, species diversity and ecosystem diversity.
5 0
3 years ago
I NEEEEDDD HELP PLEASE
Aleks04 [339]

Answer:

Digestive, excretory, circulatory, lymphatic, respiratory

Explanation:

digestive is your stomach

excretory is your colon

circulatory is your heart

lymphatic is your white blood cells and others

respiratory is your lungs

I'll go more in-depth in the comments but I think you need answers now

4 0
3 years ago
Bones provide attachments that allow skeletal muscles to cause movements? True or false
Tju [1.3M]

Answer:

True ...........................

7 0
3 years ago
When looking at your pictures in order, describe the changes to the area. What changes happened first? Why do you think that is?
Veronika [31]

Answer:

5. no i think that its the same as number 2 because based on number 2, at first there is climate change but then, flowers began to grow which is similar to the pictures protrayed in the website where at first forest trees are burned and then colonizing trees helped to change the landscape

hope this helps! :)

7 0
3 years ago
Read 2 more answers
An older adult female patient has presented with a new onset of shortness of breath, and the patient's nurse practitioner has or
Marizza181 [45]
Shortness of breath or difficulty in breathing is also called dyspnea and can be acute or chronic. It has various causes, but mainly can be caused by a problem in the heart or the lungs. Since your heart and lungs are both involved in the transportation of the oxygen to the tissues and the removal of carbon dioxide, any problems occurring to these systems can affect breathing.
B-type Natriuretic Peptide (BNP) reflect the systolic and diastolic activity of the heart and its blood levels can show any heart failure. A BNP test and can help the nurse decide whether the cause of the dyspnea is a heart failure or some respiratory problem. 
7 0
3 years ago
Other questions:
  • What type of energy does a heated oven have?
    5·1 answer
  • Identify 2 things that can cause mutations
    7·1 answer
  • If you remove the biological (etiologic) contamination hazards through destroying microorganisms and their toxins, what mechanis
    15·2 answers
  • Receptor is on plasma membrane<br> a. peptide<br> b. steroid
    5·1 answer
  • If you toss a coin 5 and it lands on heads each time, can you expect the coin to land heads up on the sixth toss? Explain.
    5·1 answer
  • What does Vivian Lee research? *
    7·1 answer
  • Which statement is true about the cells in multicell organisms?
    15·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Whats the answer to this
    11·1 answer
  • Why are weather observations taken?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!