Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
Cytokinesis takes place in both meiosis and mitosis and performs the separation of he cell in half and form one nucleus into each daughter cell.
If cytokinesis did not happen, it will from multinucleated cells which means that their will be multiple nuclei in single cell and cell will not get separate in half, and no new daughter cells will form.
The sodium and potassium ions are transported using a sodium potassium pump the process of moving sodium and potassium ions across the cell membrane.
pressure would be described as the force that is on an object
