During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Yes, people should try to save Asian elephants. They are hunted and killed for their tusks. These parts of their body are used for medicinal reasons. Many people “save” elephants by trimming off their tusks, making it so that killing the animal would be meaningless.
(Hope this is what you wanted, I learned this in a documentary forever ago.)
Short explanation: Elephants are in danger due to poachers, they hunt them for their tusks.
Don’t know how much you needed but here you go
A single change or alteration in the nucleotide base of the genetic material of the cell is called a point mutation. It can be a deletion, addition or inversion of a single nucleotide base.
In the following, the mutations that occurred are 1. C and 2. B.
<h3>How the mutation can be explained?</h3>
- <u>Silent mutation</u> occurs in a single base of the triplet codons of the bases but the alterations do not cause an observable effect and they remain as a neutral alteration. They do not affect the function of the protein. Thus, the glycine to glycine is a silent mutation.
- <u>Non-sense mutations</u> are caused when the single change in the nucleotide base results in the formation of the stop codon. Thus, lysine to stop codon is a nonsense mutation.
Therefore, silent and nonsense mutations are the correct options.
Learn more about point mutation here:
brainly.com/question/10473763
Answer:
guanine, adenine, cytosine,
Explanation:
