1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
creativ13 [48]
3 years ago
8

Hair Coloring Experiment

Biology
1 answer:
leva [86]3 years ago
5 0

The independent variable (hair<em> colorin</em>) causes a <u>response</u> in the dependent one (colorin <em>effectiveness)</em>. The constant variable <u>can not change</u> (<em>curly or straight</em>), the control variable is <u>kept constant</u> (<em>time and environmental conditions</em>). The experimental group receives the <u>treatment</u> (<em>40 students</em>).

------------------------------------------------

INDEPENDENT VARIABLE

Refers to all the variables in an experiment that provoke a response in another variable. The independent variable is modified to analyze its effects on another variable. The researcher changes on purpose the independent variable to observe the response of the dependent variable.

<em>In the exposed example, the independent variable is the red hair coloring </em>

<em>- Red Hair Paint</em>

<em>- L’Oreal</em>

DEPENDENT VARIABLE

Refers to the variable, which response depends on any change in the independent variable. The change in the dependent variable might be proportional or inversely proportional to the change in the manipulated variable.

<em>In the exposed example, the dependent variable is the coloring effectiveness, seen through how well the coloring takes and lasts. </em>

CONSTANTS

This variable does not change during the whole experiment and under any circumstance. It <u>can not change</u>.

<em>In the exposed example, the constant variable is the type of hair, curly or straight. </em>

CONTROL

Controlled variables are kept constant in the control groups and the experimental groups. Unlike the independent variable, the controlled variables do not influence the results. These variables do not affect the response of the dependent variable.

<em>In the exposed example, the controlled variables are the exposure time to the colorings and environmental conditions, such as temperature, humidity, etc.</em>

EXPERIMENTAL GROUP

The experimental group receives the treatment. The researcher apply different treatments to the experimental groups to observe how they affect the dependent variable. There can be several experimental groups.

<em>In the exposed example, the general experimental group is the 40 students' hairs. Because coloring does not have the same effect on different hair colors, the experimental group includes,</em>

<em>- 10 blonds, </em>

<em>- 10 brunettes, </em>

<em>- 10 with black hair</em>

<em>- 10 with red hair</em>

<em>-------------------------------------------</em>

<em>Related link: brainly.com/question/24653783</em>

You might be interested in
Describe the structure of a typical bone
Paladinen [302]

Answer:

The outside of the bone consists of a layer of connective tissue called the periosteum. Additionally, the outer shell of the long bone is compact bone, then a deeper layer of cancellous bone (spongy bone) which contains in the medullary cavity the bone marrow.

7 0
3 years ago
Pls help it’s due today at 1:00 pm
Softa [21]

Answer:

The mutation is on chromosome/karyotype 8.

3 0
2 years ago
Biochemical changes in the body, that affect the rate of metabolism and elimination of a substance from the body and produce inc
ahrayia [7]

Answer:

Tolerance

Explanation:

Tolerance is the capacity of an organism to survive changes in certain environmental and biochemical conditions. It has to with changes an organism is able to withstand when is subjected to certain factors which can biotic or abiotic.

For example, in the consumption of alcohol, tolerance can occur when there is a fast elimination of alcohol from the body system. This is usually as a result of the activation of a group of enzymes that is responsible for the metabolism of alcohol in excessive alcohol drinkers. The activation of this enzymes increases the catabolism of alcohol and hence reduces the active time within the body, hence reducing the time by which alcohol intoxicates.

6 0
3 years ago
When the influenza virus enters into an epithelial cell within the respiratory tract, the infected cell responds by
Lena [83]

When the influenza virus enters an epithelial cell, the infected cell responds by posting antigens and acting as a flag for cytotoxic T cells.

<h3>What is the cell-mediated response?</h3>

The cell-mediated response is a type of immune response where the organism is able to respond to pathogens by immune cells.

Macrophages (as well as other immune cells ) can act during cell-mediated immune responses.

In conclusion, when the influenza virus enters an epithelial cell, the infected cell responds by posting antigens and acting as a flag for cytotoxic T cells.

Learn more about cell mediated responses here:

brainly.com/question/24378503

#SPJ1

8 0
2 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Other questions:
  • For this question, we will utilize a population of Martians that is in Hardy Weinberg Equilibrium. The dominant Martian phenotyp
    13·1 answer
  • If ATP hydrolysis to release energy is inhibited, how would this impact transport across the cell membrane? (3 points)
    6·1 answer
  • Recall that in the big Yellowstone fires, lodgepole pines burned and then grew back within several decades.
    9·1 answer
  • What species are dragonflies most closely related to?
    7·2 answers
  • At least 5 cute livestock pig names for both genders
    11·2 answers
  • . Corn has small, colorless, odorless, lightweight flowers without petals. What is the significance of these flowers in the poll
    10·2 answers
  • Which correctly lists the three parts of soil that are classified by their particle size? bedrock, humus, and clay clay, bedrock
    15·2 answers
  • Which of the following is not part of the cell theory? (4 points) Every living thing is composed of cells. Cells come from pre-e
    9·2 answers
  • Arrange the following statements about DNA replication in the correct order.
    5·2 answers
  • Ginamit sa bubungkal ng lupa sa paligid ng halaman? ano ang pangalan nito​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!