1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elanso [62]
3 years ago
13

Consider the following claim: Group behavior can increase the chances for an individual and a species to survive and reproduce.

Biology
1 answer:
lozanna [386]3 years ago
3 0

Explanation:

Claim: Group behavior can increase the chances for an individual and a species to survive and reproduce. Evidences for the claim: As the claim suggests that group behavior is favorable for organisms, it increases their chance of survival and reproduction. First of all we have to understand what is group. Group is a collection of same kind of organisms that travel, live as well as perform daily life work together. When organisms are living in a large group they have better chances to find a mate. Living in a group helps the organisms to save them from the attack of predators, because unity is strength. Large groups have more power to access food sources and can find ample source with the assistance of fellow members, than solitary animals. Additional reputable evidence: We have often seen the birds that they form a V shape when they fly in air in a group. Now, this group formation in V helps those birds to navigate their pathways in a better way. They have more chances to reach in their destination even if that is far off from their place of departure, because the whole group's navigating ability help to reach a destination faster. They are better able to reproduce, survive there. Similarly when fish swim in groups, they can avoid the attack of predators and are better able to swim for a longer period of time to reach theri destination. Conclusion: Group behavior equips the organisms with protection and support. It better adapts an organism to survive the harsh effects of the environment.

Read more at Answer.Ya.Guru – https://answer.ya.guru/questions/3649454-consider-the-following-claim-group-behavior-can-increase-the.html

You might be interested in
How long is a gestation period for a mouse
melisa1 [442]

Answer:

an average of 3 weeks (19-21 days)

Explanation:

3 0
3 years ago
Using the drop-down menus, identify the
Harman [31]

Answer: label A - dna

label B - cell membrane

label C - ribosomes

label D - cytoplasm

Explanation:

7 0
3 years ago
One of the common surface features of karst landscapes are sinkholes, also known as ________.
cestrela7 [59]
Dolines. I just looked it up on Quizlet. If you need answers, make an account on Quizlet and get the answers on their flash cards.
4 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Human embryos have tails, which become tail bones before birth. Tails also appear in fish, reptiles, amphibians, birds, and mamm
lana [24]

Answer: a close evolutionary connection between humans and many other mammals

Explanation:

8 0
2 years ago
Other questions:
  • The region of colder, denser water found in the deepest zone of a lake in summer is called the __________. the region of colder,
    14·1 answer
  • In the Great Lakes, there are over 3,500 types of organisms that cannot produce offspring with each other. All of these differen
    8·1 answer
  • Plants and animals release co2 into the atmosphere is called
    9·1 answer
  • Where does translation take place? hints where does translation take place? endoplasmic reticulum golgi apparatus ribosome nucle
    10·1 answer
  • Rough endoplasmic reticulum definition and function
    8·1 answer
  • a cell has 10% salt solution and 90% water solution,while the beaker has 30% salt solution and 70% water solution. what happens
    5·1 answer
  • During a blood drive, Shaun noticed that the nurse punctured his vein to connect the tube for withdrawing blood. Why is blood ob
    14·2 answers
  • What is the name of the polysaccharide that plant use to store the sugar that is produced in photosynthesis
    15·1 answer
  • A hand lens or magnifying glass is strong enough to view cell organelles.<br><br> True<br> False
    5·1 answer
  • What causes sublimations to happen <br><br>​
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!