1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergio [31]
3 years ago
13

Snake venom contains a mixture of enzymes, which include phospholipase that break down cell membranes, proteinases that destroy

proteins, as well as amino acid oxidases and nucleotidases that break down the monomers for protein and DNA synthesis, which is why they can be so deadly. If you were bitten by a venomous snake you may be treated with an antivenom. In addition to antibodies that help your immune system recognize and fight the foreign molecules, what else does the antivenom most likely contain
Biology
1 answer:
Alik [6]3 years ago
3 0

Answer:

The correct answer is - Venom enzyme inhibitors.

Explanation:

The snake venoms are the complex mixtures of phospholipase A2s, disintegrins, serine proteases, C-lectins, and metalloproteases, and others. The snake venom phospholipase A2s (svPLA2s) enzymes found in most of the families of venomous snakes that cause anticoagulant effects, cardiotoxicity, neurotoxicity, and cytotoxicity, and other effects.

In antivenom, there are Venom enzyme inhibitors other than antibodies that help in neutralizing these enzymes by weakening or inhibiting these toxic actions.

You might be interested in
What are the ways scientists determine an organism's phylogeny?
suter [353]
Carbon dating

hope it helped 

8 0
3 years ago
How many chromosomes will be in a fertilized egg if the sperm has a monosomy disjunction error?
Naddika [18.5K]

Answer:

Inherited disorders can arise when chromosomes behave abnormally during meiosis. Chromosome disorders can be divided into two categories: abnormalities in chromosome number and chromosome structural rearrangements. Because even small segments of chromosomes can span many genes, chromosomal disorders are characteristically dramatic and often fatal.

35 chromosomes

Explanation:

hope its help

8 0
3 years ago
Read 2 more answers
For a scientist, assessing the validity of information requires
ahrayia [7]

Answer:

The correct answer is letter C. Experimentation.

Explanation:

For a scientist, assessing the validity of information requires experimentation. In statistics and sciences, the validity of an information has no agreed definition but it generally refers to the how the concept is being experimented before reaching to the point of conclusion.

7 0
3 years ago
Read 2 more answers
What is hepatitis c​
Mrrafil [7]

Answer:

Virus

Explanation:

Hepatitis C virus, a member of the Hepacivirus C species, is a small, enveloped, positive-sense single-stranded RNA virus of the family Flaviviridae. The hepatitis C virus is the cause of hepatitis C and some cancers such as liver cancer and lymphomas in humans

5 0
3 years ago
Read 2 more answers
Give two ways to preserve and conserve endemic species.​
Jobisdone [24]

Educate your family about endangered species in your area.

Recycle and buy sustainable products.

Recycle and buy sustainable products.

Reduce your water consumption.

Volunteer. If you don't have money to give, donate your time

6 0
3 years ago
Other questions:
  • What term is used to describe a linear sequence in which energy is transferred from one organism to the next?
    9·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • You are examining a cell under the microscope and see what appear to be four sister chromatids bound together and remnants of th
    6·1 answer
  • What type of muscle is found in the leg
    6·1 answer
  • The top layer of Earth is called soil.<br> True or false
    14·2 answers
  • Ernest was looking at the following diagram of a cell. Which statement best explains how he should classify the cell?
    5·1 answer
  • Which process involves a decrease<br> in temperature?
    9·1 answer
  • Which statement best describes the components of nucleic acids?
    11·1 answer
  • Life on Earth has been influenced by what three large scale processes.
    13·1 answer
  • Why are microorganisms used to produce enzymes?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!