1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
babymother [125]
3 years ago
7

PLEASE HELP!! I NEED THIS ASAP!

Biology
1 answer:
Nadusha1986 [10]3 years ago
8 0

1. oxygen

2. co2

3. co2

4. oxygen

producers: photosynthetic plants

consumers: humans or any life that breathes oxygen

How are each of the spheres connected to the carbon cycle?

biosphere: regions occupied by living organisms need the carbon cycle to survive.

geosphere: is the habitat of the biosphere, w/o the geosphere plants would not be able to perform carbon fixation.

atmosphere: carbon cycle can contribute to global warming.

anthrosphere: involves the external environment and plants, so the carbon cycle is present.

hydrosphere: carbon cycle still happens in submerged plants as sunlight can pass through water.

How is the growing human population going to affect the carbon cycle?

more humans means more carbon being produced. more co2, more cars, more pollution being expelled into the air. Some things that can occur with the carbon cycle include an excess of co2 being present in the air as there isn't enough plants to efficiently remove it from the air, which can lead to co2 buildup in the atmosphere resulting in climate change.

if this helped, please give this brainliest!

You might be interested in
Mitosis and meiosis are processes by which animal and plant cells divide. Which statement BEST describes a difference between mi
kicyunya [14]
C.mitosis produces genetically identical daughter cells.
5 0
3 years ago
Read 2 more answers
Overall, how has science impacted human health?
mixas84 [53]

Answer:

The correct answer is: <em>C. Increased average lifespan to 78 in the US.</em>

Explanation:

Science has impacted human health by increasing the average lifespan to 78 in the US. Over the last couple of decades, the life expectancy of Americans has increased significantly than what it was 200 years ago. This can be attributed to:

1. Vaccinations- Since the invention of vaccinations, diseases such as tuberculosis, cholera and polio which were major causes of death 200 years ago have virtually been eradicated in the US.

2. Abundant and safer foods available- Commercial and large scale farming has made a wide variety of nutritious foods easier to obtain.

3. Improved sanitation- Safer drinking water, sewage treatment and stricter food inspection has significantly reduced the rate of illnesses due to poor hygiene and sanitation.  

In these ways, science has impacted human health by increasing the average lifespan to 78 in the US.

8 0
3 years ago
Mercury’s natural state is where the atoms are close to each other but are still free to pass by each other. In which state(s) c
kirill115 [55]

Answer:

solid or liquid

Explanation:

Dm for more help

4 0
3 years ago
Read 2 more answers
Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
umka2103 [35]

Answer:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Explanation:

<em>The complementary strand is :</em>

(5')GCGCAATATTTTGAGAAATATTGCGC(3')

<em>The base sequence of the complimentary strand is:</em>

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Because this sequence is self-complementary, the individual strands can form  hairpin structures. The two strands together may also form a cruciform.

Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.

  1. DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis,  bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
  1. Hairpins can also be formed from double-stranded DNA  as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
6 0
3 years ago
2. How do the bases bond together?
telo118 [61]
A bonds with T in DNA
A bonds with U in RNA
G bonds with C IN DNA

In RNA, the only difference with the code is uracil takes thymines place
4 0
3 years ago
Other questions:
  • Did ponce de leon have kids who are there nam
    6·1 answer
  • What is the space in the middle of the mitochondrion called?
    15·1 answer
  • Which is a fuction of the protein hemolobin
    13·1 answer
  • When did Homo sapiens first evolve
    7·2 answers
  • Help from the image? Thanks
    6·2 answers
  • Which is the best example of water regulating an organism’s body temperature? a jogger sweating after a run a fish passing water
    10·1 answer
  • The pancreas secretes the hormones insulin and glucagon for homeostatic control of ______ levels in the blood. A. Glucose B. Sod
    13·1 answer
  • QUICK HELP!! Describe the classification of plants. Be sure to include the two major groups and explain how they are further div
    12·1 answer
  • A Tt plant is crossed with a Tt plant. What percentage of the offspring will be short?
    7·2 answers
  • What is life?platinum grade​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!