1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yaroslaw [1]
3 years ago
15

PLEASE HELP MEEEEEEEE ILL MARK YOU AS BRAINISET

Biology
2 answers:
user100 [1]3 years ago
5 0

Answer:

Surfer's town

Explanation:

Hope you get it right

Effectus [21]3 years ago
4 0
Hold up. let me look at it rq. i’ll reply with the answer
You might be interested in
Fish that can survive saline and freshwater environments can be found in
bazaltina [42]
<span>Fish that can tolerate a wide range of salinity at some phase in their life-cycle are called euryhaline species. These fish, which include salmon, eels, red drum, striped bass and flounder, can live or survive in wide ranges of salinity, varying from fresh to brackish to marine waters.</span>
8 0
3 years ago
A phage is a virus that infects bacterial cells. A phage virus is shown above. What component of the phage virus is indicated by
Setler [38]

Answer:

<u>D) the nucleic acid (either DNA or RNA)</u>

<u />

Explanation:

Phages, or bacteriophages are viruses that infect bacteria.They have varying shapes, and sizes, and may contain one of two kinds of nucleic acid; these are RNA and DNA.

The nucleic acids  are made up of nucleotides. These are  genetic storage biomolecules made up of the monomers ribonucleic acid (RNA) deoxyribonucleic acid (DNA).

8 0
3 years ago
What would be the complimentary strand for the DNA sequence <br> ATAACGA
vladimir1956 [14]
I believe it is TATTGCT
6 0
3 years ago
Read 2 more answers
An arrow is fired at a target on a high wall. Which statement correctly describes the change in the energy of the arrow as it mo
Sedbober [7]
The correct answer in this case would be (despite you not providing us with any answers) that when the arrow was fired o a high wall, when it started flying upwards it had a lot of kinetic energy that was slowly being lowered while potential energy was being increased and peaked when it was at it highest peak, while kinetic energy at the time was at its lowest. 
3 0
3 years ago
Read 2 more answers
What is stripped from each water molecule
Iteru [2.4K]
The HS is stripped from each O

8 0
3 years ago
Read 2 more answers
Other questions:
  • Explain what the vertical bars on a climate diagram show
    11·1 answer
  • Type of muscle tissue comprising the heart
    11·1 answer
  • One of waters unique properties is that it has strong surface tension what do you predict would happen if water had weak surface
    11·1 answer
  • Which process squeezes layers of sediment together?
    8·2 answers
  • What is the importance of the genetic code?
    10·1 answer
  • What is a carbon atom?
    5·1 answer
  • How much energy is passed on to the next trophic level? *
    12·1 answer
  • A plant has two alleles for color. the red allele is recessive and is represented by q. the purple allele is dominant, and repre
    5·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • Why are surfaces for muscle attachment rough?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!