Answer:
<h2>A
</h2>
Explanation:
1. The cell is present in some type of cells. It is found in plants and bacteria and some others. It is present or found outside the plasma membrane.
2. The functions of cell wall are that it provides tensile strength and protection to the cell against many type of stress. It also plays very important role in many others protections for the cell. There are two layer, named as primary cell wall and secondary cell wall.
3. Composition of Plant cell walls is that they are primarily made of cellulose. Cellulose fibers are linear long polymers of around 100 molecules of glucose. These fibers cluster into bundles, known as or called microfibrils. In plants the microtubule cytoskeleton are present, and there function is that they directs the orientation of cell wall as in which orientation cellulose is deposited in the cell wall.
Answer:
maltose
Explanation:
Amylase, any member of a class of enzymes that catalyze the hydrolysis (splitting of a compound by addition of a water molecule) of starch into smaller carbohydrate molecules such as maltose (a molecule composed of two glucose molecules).
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
B
Explanation:
I mean, what explanation does this need?
Big growth is
<span>macroevolution as small growth is to microevolution</span>
