1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
artcher [175]
3 years ago
8

PLEASE HELP ASAP!!!!!!!!!!!!Which of the following is likely true of a wetland but not a lake?

Biology
1 answer:
erik [133]3 years ago
4 0

Answer:

I would say B- Is home to many different organisms

Explanation:

Hope this helps :) Have a great day!

You might be interested in
Public health officials are growing increasingly concerned about zoonotic diseases.
marysya [2.9K]
For the answer to the question above, I believe the answer is "<u><em>TRUE</em></u>"
Zoonoses are infectious diseases that can be transmitted between animals and humans.
<span>Some animals carry harmful germs that can be shared with humans and  can probably cause <span>illness like bird flu virus
</span></span>



7 0
3 years ago
Which statement about climax community is true?
Svet_ta [14]
The answer to this question is c! Thanks for posting your questions!

6 0
3 years ago
Read 2 more answers
A cross section of a seed is shown.
cluponka [151]

Answer:x is embryo :D

Explanation:

7 0
3 years ago
Why is it important to save energy in our daily lives
tia_tia [17]

Answer:

So you can be more active and do different things that need energy

Explanation:

4 0
3 years ago
Read 2 more answers
How does the ocean conveyor belt affect the climate in western europe ?
MakcuM [25]
It affects it by the warm waters in the gulf stream. Making the temperature up near Great Britain and Ireland Portugal etc. Much more mild then it would be per say in Eastern Canada. It's mainly affected by the Gulf Stream having it's waters flow upwards towards the countries listed.
3 0
4 years ago
Read 2 more answers
Other questions:
  • How is the atp formed during photosynthesis
    13·1 answer
  • Kari is having lunch with a friend who has been just diagnosed with cancer. what kind of listening is likely to occur?
    8·1 answer
  • A bowler getting strike during a particular frame has an estimated probability of 41%. If several simulations of the bowler bowl
    8·2 answers
  • Select the correct answer from each drop-down menu.
    11·2 answers
  • By which process do plants obtain carbon from the atmosphere
    6·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Human activities lead to the introduction of certain species that tend to dominate and disrupt habitats. Which is the term for t
    9·1 answer
  • (20 points) {brainliest} PLEASE HELP MEEEE &lt;33333
    9·2 answers
  • Cells often need to take in materials from their environment which are
    9·1 answer
  • The feelings of heat and pain associated with eating hot peppers are primarily due to what mechanism?.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!