1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marin [14]
3 years ago
5

What are the major effects of poverty, chronic stress, and susceptibility to disease in children?

Biology
1 answer:
Softa [21]3 years ago
7 0
Poverty, chronic stress and susceptibility in children result in SIGNINFICANT HARDSHIP, POOR ACADEMIC PERFORMANCE AND CADRDIOVASCULAR DISEASES.
Poverty, chronic stress and diseases usually lead to psychological disorder in children. Most of the time, these disorders are neglected because children do not exhibit symptoms like that are exactly like those of adults going through similar conditions. Psychological disorders in children ultimately result in poor academic performance and other adverse effects.<span />
You might be interested in
When the left and right sides of an animal’s body are mirror images of each other, it is referred to as being
wlad13 [49]
The answer is bilateral symmetry
3 0
3 years ago
Read 2 more answers
What is sensory neurone?
leva [86]
Sensory neurons are types of brain cells that convert the stimuli coming from the senses (hearing, touch, smell, taste, and sight) into information that would allow the brain to interpret it as a sensation. For example, they convert the messages from the optical nerve if the object is of a light color or not.
3 0
3 years ago
Study the diagram of the selectively permeable membrane below.
sveta [45]
There’s no diagraaaammmmm.
4 0
3 years ago
Which of the following phrases best describes the
vesna_86 [32]

Answer:

The best description of the function of meiosis is that <em>it conserves chromosome number, produces haploid cells.</em>

8 0
3 years ago
How is climate change relate to Environmental science
ankoles [38]

Answer:

Explanation:

Well, climate change is directly related to the environment. It effects everything around us, such as animals, plants, the ozone layer, different climates, etc.

3 0
2 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What's the job of the iris
    13·1 answer
  • Jenn and her friends are pushing her car from the back with a force of 1407 N. Which of the following forces if applied to the f
    11·1 answer
  • Why is far less energy available to top predators than to first level consumers in a food web?
    13·1 answer
  • WILL GIVE 30 POINTS, PLEASE ANSWER QUICKLY! A cable-stayed bridge is similar to a suspension bridge, but is more efficient for m
    14·1 answer
  • Why do u think heart disease is so prevalent in yhe United States
    7·1 answer
  • Which of the following investigations would likely increase the density of ocean water?
    14·1 answer
  • All insertion sequences (is elements) contain two features that are essential for their movement. what are these two elements?
    11·1 answer
  • Can someone please help me??? Smart in science?
    9·1 answer
  • Q: Predict and describe some possible effects to your entire food web if the following happened:
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!