1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mama L [17]
3 years ago
6

Oum-tdbs-cds come on join​

Biology
1 answer:
zalisa [80]3 years ago
8 0

Answer:

yomd-adhf-jkfs

lol

hehehehe

You might be interested in
A botanist has discovered a new plant species and is trying to classify the plant. Its seed has one cotyledon, it has six flower
AysviL [449]
The plant is classified as a Monocot.

Monocotyledons have only one cotyledon in the embryo. Its leaf veins are parallel. Its petals are in the multiples of three. It has a fibrous root pattern. It does not have a secondary growth. It does not have a cortex and its stem and vascular system is composed of bundles of vascular tissue scattered all throughout the stem without any specific arrangement.

6 0
3 years ago
Read 2 more answers
Why is diffusion and osmosis important?
masha68 [24]
<span>Diffusion and osmosis are important to cells because they don't require energy to transport very important molecules such as water and steroids.</span>
6 0
3 years ago
After cytokinesis what phase do cells enter?
ruslelena [56]

Answer:

After Cytokinesis, the cells return to Interphase

8 0
3 years ago
Match each description with the correct form of energy.
melamori03 [73]

chemical energy = 3

mechanical energy = 5

heat = 4

gravitational energy = 1

light = 6

nuclear energy = 2

I had the same question, and this is what I did.

7 0
4 years ago
What is erythrocytopenia?​
USPshnik [31]

Answer:

Medical Definition of erythrocytopenia

: deficiency of red blood cells. — called also erythropenia.

Explanation:

If you like my answer than please mark me brainliest thanks

8 0
3 years ago
Other questions:
  • Natural selection is a primary mechanism leading to evolutionary change. Which of the following is a trait that some living thin
    10·2 answers
  • In the laboratory, you are studying TrbL, a 70 kD protein that causes tribbles to be furry. You isolate a 70 kD protein that you
    6·1 answer
  • Which of the following is the largest?
    9·1 answer
  • A couple has three children, two without sickle cell anemia and one with sickle cell anemia. The mother has sickle cell anemia a
    9·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What is the difference between bone and cartilage? Give examples of each.​
    6·2 answers
  • Which of the following is NOT an example of a plant adaptation towards success in their habitat.
    6·1 answer
  • Why was water used to dilute the substances instead of another chemical?
    6·1 answer
  • Relation of animal and plants in ecosystem<br>need more explanation plss<br>​
    6·1 answer
  • Some biological anthropologists analyze human remains to provide legal evidence. this special type of anthropology is known as:_
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!