What is the role or purpose of mitotic cell division in the root tip of a plant and in the blastula stage of an animal?

Biology

1 answer:

RoseWind [281]3 years ago

6 0

The Role of blastula is Blastula is this and that and Yh they should gather everyday to stage the Animals

You might be interested in

We used the enzyme, taq polymerase, which is derived from the thermus aquaticus bacterium, in our pcr procedure. Why is this enz

wel

The enzyme Taq polymerase is required in the PCR process because it is the main enzyme that synthesizes the new DNA strands complementary to the template strand and without the activity of this enzyme the PCR will be useless and it cannot make the copy of the given strand in any way. Thus, this enzyme is very much necessary for the efficient working of the PCR.

Polymerase Chain Reaction is a very efficient technique that can able to detect and copy even a small amount of DNA by performing a set of reactions at different temperatures.

The PCR process begins with the denaturing of the template strand at 95°C, followed by annealing in which the appropriate primers bind to the single strands of DNA at 50-56°C, followed by extension at 72°C in which the thermostable Taq polymerase synthesizes the strand complementary to the template DNA.

Learn more about PCR here

brainly.com/question/19670710

#SPJ4

5 0

1 year ago

I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran

Anarel [89]

Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.

4 0

3 years ago

Appositional growth ends in

adell [148]

The answer would be (C) i believe.

3 0

2 years ago

Read 2 more answers

30 points

MA_775_DIABLO [31]

I'm working on the assignment rn. But here are some clues to help you.