1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KIM [24]
3 years ago
5

Based on genomic studies, when did a change in gene sequences occur that lead to a change in the way that the brain processes sp

eech? between 1 and 6 million years ago between 4 and 9 million years ago between 10,000 and 100,000 years ago approximately 25,000 years ago approximately 12,000 years ago
Biology
2 answers:
xxTIMURxx [149]3 years ago
6 0
The answer for this question would be the second option. Genomic studies cover the analysis of the changes of genome by scanning the markers across complete sets of DNA. Based on these studies, the change in gene sequences happen that resulted to a change in the way that the brain interprets speech in between 4 and 9 million years ago.
patriot [66]3 years ago
3 0

Answer:

Option B, between 4 and 9 million years ago

Explanation:

It took million of years for human being to evolve from its ancestral animals. The time required to evolve was basically due to the time consumed in upgrading the cognitive thinking process of human being.

Nearly 2 million years were required to develop the cerebral cortex  and hence expand its abilities.

A gene named FOXP2 evolved by positive selection  and played an important role in the evolution of human speech and language.  It took nearly the same time by humans to develop speech as the time required by human to evolve from chimpanzees.

Hence, option B is correct

You might be interested in
What happens to the average heart rate as a mammal holds their breath?
3241004551 [841]

Answer:

The heart beats slowly because oxygen consumption is reduced

3 0
3 years ago
The endosymbiotic theory _____.
11111nata11111 [884]
2. The endosymbiotic theory suggests that a eukaryotic cell is the result of one prokaryotic cell eating another.
5 0
3 years ago
Read 2 more answers
Enzymes are sensitive to pH and temperature. If an enzyme’s environment is too hot, the enzyme cannot
musickatia [10]

Answer: I thought I have answered this question before. Yes emzymes are sensitive to PH and temperature.

Explanation:

if the temperature is above 60 - 70 degree celcius, it looses it's ability to catalyse as such emzymes are kept within the normal body temperature to function effectively. Emzymes are also sensitive to PH changing the pH of its surroundings will also change the shape of the active site of an enzyme and also changing the pH will affect the charges on the amino acid molecules.

8 0
3 years ago
Read 2 more answers
Phytoplankton form the base of food webs, but are only present in the upper few hundred meters of the ocean. A number of factors
Ksenya-84 [330]

Answer:

The correct answer is d. Oxygen

Explanation:

Phytoplanktons are responsible for the fixation of approximately half of the global carbon therefore seawater has high CO2 concentration which is required by phytoplanktons to make their food.  

They are the primary producers of oceans and they are responsible to support the food chain of oceans. Factors that can limit their growth are mainly sunlight and nutrients like phosphorus, nitrogen, etc.

As phytoplanktons are photosynthetic they release oxygen itself as a byproduct therefore oxygen is not a limiting factor to phytoplanktons. So the right answer is d.

6 0
3 years ago
For months a baby grows in a special place inside its mother called the
Iteru [2.4K]
The answer is uterus, well that's what I got
7 0
4 years ago
Read 2 more answers
Other questions:
  • Knowledge of the driver mutations underlying cancer has led to targeted therapeutics, such as the protein kinase inhibitor imati
    12·1 answer
  • Two different populations of birds live in the same area and eat the same type of food
    12·1 answer
  • How does an adult sponge asexually reproduce
    15·2 answers
  • What interactions are occurring that allow the water to move against gravity in capillary action? Select three options.
    14·1 answer
  • Organización política del mundo
    14·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Assignment
    14·1 answer
  • Plz help me with my mothers quiz. I will give brainliest. I appreciate all ppl that help thank you so much.
    15·1 answer
  • ________ are cells that make up the brain and spinal cord and transmit electrical signals from receptor to effectors.
    15·1 answer
  • What is the result of crossing over, as shown in the illustration? o the chromosomes replicated o the chromosomes condensed o th
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!