1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lisabon 2012 [21]
3 years ago
6

A student conducted an experiment to observe what happed a plant cell when paced in different solutions. Analyze the following o

bservation of a plant cell. What is the best explanation of the movement of molecules?
A normal plant cell is on the left. The plant cell wall is visible, and the internal structure fills the cell up to the cell wall. In the middle is an arrow pointing from left to right. On the right is a plant cell. This plant cell has a cell wall the same size as the first plant cell, but the internal structures are shrunken in comparison to the first cell.

Water is diffusing in and out of the cell at the same rate.
Water is moving into the cell at a faster rate than out of the cell.
Water is moving out of the cell at a faster rate than into the cell.
Water is only moving out of the cell.
Biology
1 answer:
Ainat [17]3 years ago
4 0

Answer:

Water is diffusing in and out of the cell at the same rate.

Water is moving into the cell at a faster rate than out of the cell.

Water is moving out of the cell at a faster rate than into the cell.

Water is only moving out of the cell.

Explanation:

You might be interested in
4. Describe the endosymbiotic theory and what it means to the evolution of<br> eukaryotic organisms.
VladimirAG [237]

Answer:

it explains how eukaryotes came from ancestral prokaryotes.

it theorizes that some organelles (mitochondria and chloroplasts), evolved from free-living prokaryotes that were overtaken and subsequently became obligate endosymbionants.

Explanation:

6 0
3 years ago
Please help me! Just with these few, and I will mark brainliet!
Drupady [299]

1. Electrons travel around the nucleus in fixed energy levels with energies that vary from level to level

2.protons, neutrons, and electrons have a mass, but electrons have far less mass

3.cations and protons

4. idk

4 0
3 years ago
Which interdisciplinary branch of biology most likely invented the electrocardiogram that is used to measure heart activity?
tangare [24]

Answer;

Biophysics

Explanation;

-Biophysics is the study of physical phenomena and physical processes in living things, on scales spanning molecules, cells, tissues and organisms. Biophysicists use the principles and methods of physics to understand biological systems.

-It is an interdisciplinary science, closely related to quantitative and systems biology.

-The electrocardiogram is a diagnostic tool that is routinely used to assess the electrical and muscular functions of the heart. During an ECG, sensors  that can detect the electrical activity of your heart are attached to your chest and sometimes your limbs.

5 0
3 years ago
Read 2 more answers
What type of rock is most likely to contain a index fossil within it?
garik1379 [7]

Answer:

I think it's sedimentary rock

5 0
2 years ago
The cell division process called mitosis is used to make cells called
pantera1 [17]

Answer:

gametes i belive

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • What's the difference between DNA and RNA?
    8·2 answers
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • Explain why the answer choice is right please
    11·1 answer
  • Which o the following is true about cellular resporation
    15·1 answer
  • Two plants of the same species were crossed. One of the plants had red flowers and the other plant had white flowers
    12·2 answers
  • How does a vascular system serve the needs of a plant cell??
    12·1 answer
  • Because evolution is a theory, that means:
    6·1 answer
  • All living organisms are classified into one of three domains: Bacteria, Archaea, and Eukarya. Compare and contrast the domains
    5·2 answers
  • The lac operon controls the transcription of a group of genes involved in metabolizing lactose in E. coli. A group of scientists
    13·1 answer
  • What method or technology could reduce<br> the runoff?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!