1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexandr1967 [171]
3 years ago
11

Aysha ran 400 meters in 10 minutes on Monday and she ran 825 meters in 25 minutes on Tuesday. On which day she ran faster?

Mathematics
2 answers:
LiRa [457]3 years ago
6 0

Answer:

Monday

Step-by-step explanation:

Day 1 (Monday):

10 minutes to seconds: 10 x 60 = 600 seconds

\frac{400m}{600s}= 0.67 m/s

Therefore day 1 she ran at 0.67 m/s

Day 2 (Tuesday):

25 minutes to seconds: 25 x 60 = 1500 seconds

\frac{825m}{1500s} = 0.55 m/s

Therefore day 2 she ran at 0.55 m/s

She was faster day 1 (Monday)!

Anton [14]3 years ago
3 0
First we are going to make them equal to compare

400 / 10 and 825/25
We are going to make the denominator equal so we will multiple 10 by 10 and 25 by 4 we will get 100 for both. The denominator are equal. Now multiply the nominator with the number you multiplied the denominator. So, 400 will be multiplied by 10 and 825 will be multiplied by4. We will get 4000 and 3300. Obviously she ran faster on monday
You might be interested in
If it takes 12 people 3 days to build 72 meters of fence, how many meters of fence can 15 people build in one day?
scoundrel [369]

72/3=24

24/12=2(2 meters a person a day)

2*15=30

15 people can build about 30 meters of fence a day.

6 0
3 years ago
Josh's soccer team had a competition to see which player should be the goalie. Each player tried to block 15 kicks from entering
poizon [28]
Do not click the link!
8 0
3 years ago
Change 3 to 5 in exercise 4
Nonamiya [84]
So 5 4 3 I think yeah
5 0
3 years ago
What is 1/2 times 6?
son4ous [18]
1/2 times 6 = 1/2 * 6
so in order to make this multiplication you have to turn 6 to a fraction, 6 is equal to 6/1
so , the way to multiply them is multiply the top with the top and it will be the top in the answer and the exact same with the bottoms

6*1= 6
2*1=2 

so the fraction is 6/2, since a fraction is basicly a division

6/2 = 3

so the answer to your question is 3

i hope i helped you
6 0
3 years ago
Read 2 more answers
(c) If a pizza contains 8 slices and there are 4
slavikrds [6]
2 slices per person
7 0
3 years ago
Read 2 more answers
Other questions:
  • In a poll students were asked to choose which of six colors was there favorite. The circle graph shows how the students answered
    15·1 answer
  • Please tell me if it 1 2 3 4 or 5
    14·1 answer
  • 3. It will take half an hour for Matthew to travel to
    11·1 answer
  • Find the unit cost of a store sells a dozen eggs for 1.99.
    10·1 answer
  • Need help with 5, 6, 7 i don’t know how to do it can someone help me with the steps
    10·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Can someone help me with this please ?
    15·1 answer
  • What is the nth term rule of the linear sequence below 1,7,13,19,25
    10·1 answer
  • What is the missing number? <br> URGENT PLS HELPP
    5·2 answers
  • Cash deposit into Nepal bank Rs. 50000​<br> ?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!