1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natka813 [3]
2 years ago
6

Why does snakes and frog goes for winter sleep?plz help me fßi need it's and know​

Biology
2 answers:
N76 [4]2 years ago
7 0

Answer:

this due to

Explanation:

 

When cold weather hits, snakes  must find shelter from the temperatures by burrowing in holes or caves, under logs or rocks, in tree stumps, or by making their way into basements, crawlspaces, garages, barns, sheds, wood piles, and even car engines.

Unlike many warm-blooded animals, snakes don’t actually hibernate in the winter. Instead, snakes go into a state known as brumation where snakes become less active and their metabolism slows down tremendously. Brumation is similar to hibernation in that snakes will sleep for long periods of time. They will, however, wake up to forage for food and water and if a sudden warm snap occurs and temperatures rise for a few days at a time. When the weather cools back down, they will go back into their brumation state once again. Brumation can begin anytime from September to December and last until March or April.

same for frog as well ,Frogs and toads are cold-blooded, so their body temperatures take on the temperature of the environment around them. During the winter, they go into a state of hibernation, and some can be exposed to temperatures below freezing.

pentagon [3]2 years ago
4 0

Answer:

Explanation:

Snakes, like all reptiles, are cold-blooded (also known as ectothermic). This means they regulate their body temperature by lying in the sun to warm up, or moving into the shade to cool down. Snakes that live in cold climates like ours must seek refuge in a hibernaculum throughout the winter

You might be interested in
A children's liquid medicine contains 100 mg of the active ingredient in 5 mL . If a child should receive 150 mg of the active i
wariber [46]

Answer:

The correct answer is 7.5 ml

Explanation:

The medicine contains 100 mg in 5 ml, that means that the concentration of the active ingredient is 100 mg/5 ml= 20 mg/ml

If we divide a concentration (in mg/ml) into a mass (in mg) we obtaine a volume (in mL). Thus, in order to calculate the mililiters of medicine which contain 150 mg of the active, we have to only divide mass (150 mg) into the concentration of active ingredient as follows:

mL = \frac{150 mg}{20 mg/mL}= 7.5 mL

4 0
3 years ago
What evidence did Alfred wager use to support his theory of continental drift?
Delicious77 [7]
Well he looked at the contents and saw they some of them had similar shapes so
6 0
3 years ago
A client with schizophrenia who is being admitted to a psychiatric hospital for evaluation refuses to remove dirty clothing. wha
podryga [215]
The nurse should provide clean clothing as an option for the patient, and let them know they are willing to clean their clothes and give them right back. The nurse should assure the patient that she means no harm by taking their clothes; she/he is only going to wash them. They should also deny any delusions about the nurse taking the patient's clothing.
Hope this helps!
6 0
3 years ago
What is cyclin dependent kinase?​
Bezzdna [24]

Answer:

please mark as brainliest answer as it will also give you 3 points

Explanation:

Cyclin-dependent kinases (CDKs) are the families of protein kinases first discovered for their role in regulating the cell cycle. They are also involved in regulating transcription, mRNA processing, and the differentiation of nerve cells.[1] They are present in all known eukaryotes, and their regulatory function in the cell cycle has been evolutionarily conserved. In fact, yeast cells can proliferate normally when their CDK gene has been replaced with the homologous human gene.[1][2] CDKs are relatively small proteins, with molecular weights ranging from 34 to 40 kDa, and contain little more than the kinase domain.[1] By definition, a CDK binds a regulatory protein called a cyclin. Without cyclin, CDK has little kinase activity; only the cyclin-CDK complex is an active kinase but its activity can be typically further modulated by phosphorylation and other binding proteins, like p27. CDKs phosphorylate their substrates on serines and threonines, so they are serine-threonine kinases.[1] The consensus sequence for the phosphorylation site in the amino acid sequence of a CDK substrate is [S/T*]PX[K/R], where S/T* is the phosphorylated serine or threonine, P is proline, X is any amino acid, K is lysine, and R is arginine.[1]

7 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • Similarities between seemingly unrelated organisms can be explained by Darwin s theory that organisms come from common ancestors
    7·2 answers
  • The amount of enzyme activity in a cell that is homozygous for a mutant allele is 400 units. The amount of enzyme activity in a
    14·1 answer
  • Look at this picture and help me out plz
    11·2 answers
  • In pea plants, yellow (Y) seed color is a dominant trait, and green seed color (y) is a recessive trait. Which resulting plant w
    13·2 answers
  • Question 9: What conclusion can you make regarding how humans affect biodiversity? Use evidence
    12·1 answer
  • The city wants to close one of the sewage treatment plants in an effort to save money. This would then require all sewage to be
    14·1 answer
  • Which statement about water best illustrates the property of adhesion?
    6·1 answer
  • In which era were the first dinosaur fossils found?
    12·1 answer
  • HELP PLEASE! 25 points question!
    10·1 answer
  • Task #3. Drawing the atomle structure of atoms.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!