1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erastova [34]
3 years ago
7

Define taxonomic level

Biology
2 answers:
Sonja [21]3 years ago
7 0

Answer:

In biology classification, taxonomic rank is the relative level of a group of organisms (a taxon) in a taxonomic hierarchy. Examples of taxonomic ranks are species, genus, family, order, class, phylum, kingdom, domain, etc.

Eduardwww [97]3 years ago
4 0

Answer:

In biological classification, taxonomic rank is the relative level of a group of organisms (a taxon) in a taxonomic hierarchy. Examples of taxonomic ranks are species, genus, family, order, class, phylum, kingdom, domain, etc.

You might be interested in
Which adaptive management stage helps us understand what objectives are actually met?
yarga [219]
The answer for your question is Monitor
6 0
3 years ago
Compare the structures of arabinoxylan and amylopectin. [5 marks]
Galina-37 [17]

Answer:

Marta S. Izydorczyk, in Handbook of Hydrocolloids (Third Edition), 2021

13.7.3.6 Arabinoxylans in cosmetics

Arabinoxylan derivatives, such as cation arabinoxylans and their hydrophobically modified products, are potentially useful ingredients in cosmetic and personal care products (Yang, Wuxi, & Cui, 2017). Water-soluble cationic arabinoxylans exhibit hair conditioning properties, and arabinoxylans with low-molecular-weight and high charge density can be absorbed on the hair surface. Cationic polymers are commonly used in hair conditioners as the electrostatic interactions between the positively charged cationic polymer and anionic hair surface lead to the absorption of the conditioner on the hair surface, thus making the hair soft and smooth (Fig. 13.18). Properties such as diverse structure, biocompatibility, nontoxicity, and low production costs make arabinoxylans promising candidates for these uses (US patent 2019).

Explanation:

8 0
3 years ago
The aorta is a vein. True False
Kamila [148]

False, the aorta is the major artery that takes oxygenated blood from the heart to the rest of the body.

8 0
4 years ago
Read 2 more answers
DO 6. Choose the best answer.
salantis [7]

Answer:

Columbian Exchange

Explanation:

I looked up definitions and information on all the option words, Columbian Exchange seems to be a fit for the answer.

3 0
2 years ago
Which of the following is not a part of the peer review process or it’s results
Mazyrski [523]
Is there a picture or options

4 0
3 years ago
Other questions:
  • Salts help to maintain the natural ionic concentration of an organism.<br><br><br> True or False
    12·2 answers
  • What would happen if the plant cell could not get materials it needs for cellular respiration
    12·1 answer
  • What compound causes the depletion of earth's ozone layer?
    15·1 answer
  • Why do pollution and smog often become trapped in los angeles and other similar urban areas?
    14·1 answer
  • Fevers in young children are a particular concern because oxygen is less effectively transported by hemoglobin at high temperatu
    9·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Psychology that deals with police psychology, criminal profiling, and psychological
    13·1 answer
  • The illustration below shows two waves. Each wave travels in the same amount of time.
    10·1 answer
  • Select the mRNA Strand that will be transcribed from the DNA A-A-C-C-G-G-G-T-T
    8·2 answers
  • Can someone help me on this question
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!