1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mojhsa [17]
3 years ago
5

Which characteristic does not belong to the bird class?

Biology
1 answer:
zlopas [31]3 years ago
6 0

Answer:

bones are packed solid but am not that sure

You might be interested in
How many new volumes would each new cell contain whenever a cell splits?
Elenna [48]
The specific volume will be different for various kinds of cells. The safe answer would be that the new cell will pretty much have the same volume as the one that it divided from. This is true for most eukaryotic cells unless other factors like epigenetics or mutations come into place.

One example of moments a cell would increase in volume is during hypertrophy. This simply means that the cell is increasing in size (compared to: hyperplasia -- which is an increase in number of the cells). Hypertrophy is definitely an increase in volume of the cell but this doesn't necessarily translate to cell division (i.e. just because the cell is big now, doesn't mean it will still be big when it divides).

Another moment of increasing volume of the cell and now also related to cell division would be during the two stages in the cell cycle (i.e., G1 and G2 phases). This is the growth phase of the cell preparing to divide. However when mitosis or division happens, the cells will normally end with the same volume as when it started.

This are safe generalizations referring to the human cells. It would help if a more specific kind of cell was given.
4 0
3 years ago
Read 2 more answers
This is an organism that relies on other organisms for its food and energy supply, also
lys-0071 [83]

you are right what is the question

7 0
3 years ago
Here are two types of rabbits: those that strictly eat grass and those that strictly eat berries and flowers. A drought occurs o
alisha [4.7K]

Answer:

Rabbit's population will reduce drastically

Explanation:

As it is clear from the given description, that drought adversely affects the production of flower and berries and hence the population of rabbits depending on berries and flowers will be adversely affected. Therefore, there are high chances of rabbits dying because of insufficient food during drought

Also, the foxes and hawks feed on the babies of rabbit. This further reduces the population of rabbits as the new ones are killed before attaining fertility.

Overall due to both predation (by foxes and hawks) and the drought the  population will reduce drastically.

4 0
3 years ago
The diagram above illustrates which of the following processes?
Sonbull [250]
Option A Base pair substitution
6 0
2 years ago
Read 2 more answers
How does water enter and exit the leaves
Juli2301 [7.4K]
Water enters and leaves the leaves through tiny little pores called stomata. The process is called transpiration.
8 0
4 years ago
Other questions:
  • Write an “O” next to statements that are examples of Observations and an “I” next to those statements that are Inferences. _____
    14·1 answer
  • What are the 3 main weapons of predators
    13·2 answers
  • You perform a testcross using F1 dihybrid flies. If, in the resulting offspring, the percentages of parental and recombinant off
    15·1 answer
  • Does each part of the cell work alone?
    15·2 answers
  • Differentiate between inorganic and organic nitrogenous compounds with examples.
    5·2 answers
  • 3. Which of the following shows a kinetic energy ?
    10·1 answer
  • ATG GGT CTA GCG AAA GAT IS WHAT AMINO ACID
    11·1 answer
  • I have all day, last class! answer ASAP!!!
    12·2 answers
  • Which of these resources are renewable? Check all that apply.
    6·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!