Answer:
Correct answer is A. Asia and Africa
Explanation:
It is estimated that in this period more than half population lived only in Asia, therefore A is the only correct answer.
Those percentage are going from 65 up to 70 percent. In the same time Africa had around 10 percent of world population.
Europe had up to 20 percent of world population, while Americas had only around 2 percent.
Oceania had less than one percent.
Answer:
<u>To bring awareness about the underwater volcanoes</u>.
Explanation:
- The eruption of the volcanoes, and the occurrence of the earthquakes on the planet and the spilling of the lavas, and the smoke-filled air hat comes to from the vent of the large craters.
- <u>As most people think that the volcanoes are present on the land areas only does not mean that they are confined to the above surface of earth they are also characterized by the deep hydrothermal vent and the most pope thus are surprised to know about them as they don't know that they are the primary place for the origin of the first life forms n the earth in the single-celled bacteria.
</u>
- They generally spill out the lavas and the magmas and this is called sth submarine volcanoes and ends to occur along the mid-ocean ridges. And are known to give out an estimated 75% of the volume of the lavas on earth.
- T<u>hey are also known as the seamounts that are created from the extinct volcanoes that occur in 1000 to 4000 meters depth of the seafloor.</u>
Answer:
542.5 km
Explanation:
average thickness of granitic continental crust = 35 km
Average density of crust ( from section C1 ) (pc) = 3.3 g/cm^3
Average density of mantle (Pd) = 3.1 g/cm^3
applying the concept of Isostay
attached below is the missing part of the question and solution
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
human cultures and relations may i have the brainiliest plz
