1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paha777 [63]
3 years ago
7

What is the best definition of direct cause of disease?

Biology
1 answer:
vekshin13 years ago
8 0

Answer:

D. a cause that directly leads to a normal condition without interference

Explanation:

Direct contact infections spread when disease-causing microorganisms pass from the infected person to the healthy person via direct physical contact with blood or body fluids.

You might be interested in
Anyone know this? cell cycle phases
Tju [1.3M]

Answer:

DACEB

Explanation:

8 0
3 years ago
How does the Digestive system help maintain homeostasis?
Gnesinka [82]

Answer:

The bacterial flora in the intestines are essential to homeostasis in the body, they not only break down food so the nutrients can be absorbed, they produce vitamins like biotin and vitamin K and guard against harmful bacteria that enter the system. While your heart is a vital organ, the brain (and the nervous system that attaches to the brain) make up the most critical organ system in the human body. The digestive system ordinarily gets 20% to 25% of the oxygenated blood pumped out by the heart and the receptors in muscles provide the brain with information about body position and movement, the brain controls the contraction of skeletal muscle the nervous system regulates the speed at which food moves through the digestive tract.

8 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
2 years ago
2. Why do we need carbohydrates ?Name three sources of carbohydrate in our food ​
sp2606 [1]

Answer:

Carbohydrates are the body's main source of energy. In their absence, your body will use protein and fat for energy. It may also be hard to get enough fibre, which is important for long-term health.

Carbohydrates are found in a wide array of both healthy and unhealthy foods—bread, beans, milk, popcorn, potatoes, cookies, spaghetti, soft drinks, corn, and cherry pie etc.

Explanation:

brainliest pls

3 0
2 years ago
what structure is found outside of the cell membrane of a plant cell which gives the cell its strength and shape
pychu [463]

Answer: the cell wall

Explanation:

6 0
2 years ago
Read 2 more answers
Other questions:
  • What type of cells typically do not contain cilia and or flagella
    14·2 answers
  • Gymnosperms have small male cones because ______. Select one: a. larger cones would dry out more easily b. pollen is very small
    15·1 answer
  • Producers<br> ition. Their make their
    13·1 answer
  • Ryan hit a baseball with an acceleration of 20 m/s2. The mass of the baseball is 0.5 kg. What is the force?
    15·1 answer
  • The _____ system consists of all of the nerves and cells throughout the body whose job it is to receive and transmit information
    13·1 answer
  • How many molecules of carbon dioxide (CO2) would be produced by five turns of the citric acid cycle?
    7·1 answer
  • Where did Margaret Mead live in the 1930s to conduct her study of cultural variation?
    5·1 answer
  • What cell organelle stores water for plant cells
    9·2 answers
  • Which of the following is an example of liverwort?<br> Sphagnum<br> Marchantia<br> Fontinalis
    12·1 answer
  • *
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!