1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dima020 [189]
2 years ago
15

Which of the following is not a part of the excretory passage?

Biology
1 answer:
alexdok [17]2 years ago
6 0
The mouth or something
You might be interested in
Which of the choices below forms midway between the divided nucleus during cytokinesis in plant cells?
Paul [167]
The plant cells are in a tree. The cytokinesis is the cells in a plant's top root. Soo, it is divided into 5 parts.

If you have any more questions, I'm available.


- Shelly O
5 0
3 years ago
Florida is hot most of the year. Will a cougar show seasonal changes?
rusak2 [61]

Answer:

No, because the cougar can always find a food source in Florida.

Explanation:

Brainliest pls :)

5 0
2 years ago
Read 2 more answers
A magnifying glass is an example of which type of microscope?
xenn [34]
A magnifying glass is an example of a simple microscope. The correct answer is will be D, simple microscope. 
3 0
3 years ago
Read 2 more answers
Mobombi had completed about a quarter of the distance in the marathon in which he was a participant. suddenly, he stumbled and f
maria [59]
<span>Endorphin. Endorphin are pepetide hormones secreted by the central nervous system and the pituitary gland. They inhibit the transmission of pain signals; they also produce a feeling of euphoria very similar to the ones produced by other opioids. Its 1 production is usually triggered by various human activities although they are produced in response to pain. Carrying out frequent exercise usually stimulates the release of beta-endorphin in the human brain known as runner's high. This is the probably the reason Mobombi could finish the race pain free.</span>
8 0
3 years ago
Which of the pathogens could most likely be effectively treated with antibiotics?
olga_2 [115]

Answer:

B

Explanation:

You wont need to go get antibiotics to treat a common cold, just use over the counter meds. Strep and tuberculosis are more contagious and powerful.

4 0
2 years ago
Other questions:
  • Which of the following is the simplest unit of a nucleic acid
    10·2 answers
  • How does administration of nitroglycerin help someone that might be suffering from a myocardial infarction?
    5·1 answer
  • How many planets are in the solar system?
    11·2 answers
  • Explain 3 stages of info flow in the nervous system, and explain how they are connected by sensory neurons, interneurons, and mo
    15·1 answer
  • Why do you think it is an advantage for pigs to have long uterine horns and a small uterine body, and not the opposite?
    5·1 answer
  • Human height is a trait with a very broad range of phenotypes. which patter of inheritance could account for human height? Expla
    9·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • If 2 heterozygous pea plants with yellow round seeds are crossed, what is the ratio of the yellow round seed?
    15·1 answer
  • Which description of early Native Americans is most accurate?
    12·2 answers
  • Which of these is an example of pathogen transfer via indirect contact?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!