Listen

Which of the following parts of the kidney collects the urine after it is produced renal cortex

LuckyWell [14K]

I believe the answer is the renal pelvis

3 0

3 years ago

Describe an arctic summer

aev [14]

<span>Summer temperatures in the Arctic remain cool, fluttering around zero in many places, from June through September. In fact, Arctic residents must frequently heat their homes all year long. Neighbourhoods near the sea tend to remain close to 0°C throughout the summer, but inland areas, particularly in the south, regularly reach 7°C–13°C, and hardly as much as 20°C. One reason for the opposition is that the sea ice, which gradually melts, consumes much of the sun's energy, giving little to heat the air over it.

Hope this helped! :)</span>

4 0

3 years ago

Name and describe the phase change that occurs when solid carbon dioxide (dry ice) is placed in an open container at room temper

Valentin [98]

If you put a lump of solid carbon dioxide (dry ice) in a paper cup or
on a paper plate on the kitchen counter, it gets smaller and smaller
and finally it just disappears, but you never see a puddle around it
like you would with regular ice!

Carbon dioxide has no liquid phase when the pressure on it is less than
about 5 times normal atmospheric pressure. So in the kind of pressure
that we like to live in, dry ice goes straight to gas when it melts. That kind
of behavior is called "sublimation", and we say that the dry ice "sublimes".

Every substance has some pressure limit like that. For water, it's 0.006 of
normal atmospheric pressure. At any pressure lower than that, liquid water
can't exist, and an ice cube sublimes ... it melts directly into water vapor
without a puddle.

8 0

4 years ago

Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!

Charra [1.4K]

Complete question:

Use the sequence below to answer the following questions

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

5’-TGCCTAGGAGGGATCACGCATTATGC-3’

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the <u>coding strand</u>, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

Start codon ⇒ ATG
Stop codon ⇒ TAA, TAG, TGA

5´- GCATA<u>ATG</u>CGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCA<u>TAA</u>TGCG<u>TGA</u>TCCC<u>TAG</u>GCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATT<u>ATG</u>C-3’⇒ 1 start codon near the end

5’-TGCC<u>TAG</u>GAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. <em>However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.</em>

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

8 0

3 years ago

chegg e. coli has to be grown in the presence of to the lac operon. group of answer choices lactose: repress lactose: induce glu

zhuklara [117]

<h3 />

The lac operon of E. coli contains genes involved in lactose metabolism. It's expressed only when lactose is present and glucose is absent.

<h3>How is the lac operon triggered by E. coli?</h3>

The lac operon of E. coli contains genes related to lactose metabolism. Only when lactose and glucose levels are low does it manifest symptoms. Two regulators that control the operon's "on" and "off" states in response to lactose and glucose concentrations are lac repressor and catabolite activator protein (CAP).

<h3>Why does E. coli prefer glucose to lactose?</h3>

Because it promotes quicker development than other sugars and is the first sugar to be consumed in sugar combinations, glucose is frequently the best carbon source for E. coli.

To know more about Lac Operon visit:

brainly.com/question/13626722

#SPJ4

6 0

1 year ago