1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pychu [463]
3 years ago
11

What are gross primary production and net primary production and how do they dilter? Why is this an important measure?​

Biology
1 answer:
Reptile [31]3 years ago
4 0

Answer:

food stuff and building materials

Explanation:

why is because the produce food stuff more than buidling materials

You might be interested in
One of the seed banks has been storing seeds of a rare and endangered plant to keep the seeds fresh.120 of the seeds of this pla
lianna [129]

Answer:

25%

Explanation:

According to this question, a seek stored seeds of a rare and endangered plant. In order to ensure that the seeds remain fresh, 120 seeds are selected to be grown. However, out of these 120 seeds, only 90 germinated. This means that only 90 of 120 seeds are fertile.

This further means that (120-90) = 30 seeds are infertile and hence, could not germinate. In percentage, this can be represented as:

30/120 × 100

= 1/4 × 100

= 100/4

= 25% of the selected seeds are infertile.

5 0
3 years ago
1. Cytokinesis in plant cells result in the formation of a cell plate between the new cells , while cytokinesis in animal cells
Stella [2.4K]

Answer:

Yes it is right

Explanation:

8 0
3 years ago
Small bone fractures that develop in response to repetitive, cumulative trauma are known as __________ fractures.
atroni [7]
Small bone fractures that develop in response to repetitive, cumulative trauma are known as stress fractures. These are fractures where bones are injured by overuse, they are commonly found in the spine, vertebrae, leg bones, feet, and the pelvis. They result from the accumulated trauma from repeated submaximal loading, such as running or jumping 
6 0
3 years ago
Read 2 more answers
The _______ pathway is the route from the spinal cord to the brain that carries signals from skin, muscles, tendons, and joints.
Vaselesa [24]

Answer:

The ______ pathway is the route from the spinal cord to the brain that carries signals from skin, muscles, tendons, and joints.

Explanation:

3 0
2 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • What would happen if a plant cell is placed in a solution of salt?
    7·1 answer
  • Name the following compound: 4-ethylpentane 3-methylhexane 2-ethylpentane 3-methylpentane
    8·1 answer
  • Why is it important that alhazen begin t test his hypothesis with experiments?
    10·2 answers
  • Definition: This is a machine that converts electrical energy into mechanical energy.
    6·2 answers
  • DNA, rna, and starch: what do they all have in common
    9·1 answer
  • Which process begins when an enzyme binds to a sequence of base pairs in dna?
    9·1 answer
  • Which of these BEST describes an interglacial period?
    6·1 answer
  • Organisms, like humans, look different because we share all the same variations of traits, but have different traits.
    5·2 answers
  • Which of the following is false of the integumentary system?
    12·1 answer
  • Help pls i will mark brainiest​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!