Answer:
3rd
Explanation:
A lysosome is a membrane-bound cell organelle that contains digestive enzymes. Lysosomes are involved with various cell processes. They break down excess or worn-out cell parts. They may be used to destroy invading viruses and bacteria.
Dirt inside the moist earth
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
the color of the water would be CCCCCCCCCCCC (c) BLUE
