1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna71 [15]
3 years ago
6

Once the body has begun shivering, what happens to make it stop shivering? When body temperature returns to normal, the respirat

ory system sends a message to the skeletal system to stop shivering. When body temperature returns to normal, the nervous system sends a message to the muscular system to stop shivering. When body temperature is below normal, the nervous system sends a message to the skeletal system to stop shivering. When body temperature is below normal, the respiratory system sends a message to the muscular system to stop shivering.
Biology
2 answers:
Alexus [3.1K]3 years ago
9 0

Answer:

B.) When body temperature returns to normal, the nervous system sends a message to the muscular system to stop shivering.

Explanation:

right answer on edg 2020

hope this helps!!!

Zolol [24]3 years ago
6 0

Answer:

When body temperature returns to normal, the nervous system sends a message to the muscular system to stop shivering

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Humans evolved ______billion years after the earth was formed
Novosadov [1.4K]
Humans evolved 3 billion years ago after the earth was formed.<span />
4 0
3 years ago
Which is characterized by an absence of jaws?
shusha [124]
I believe the correct answer from the choices listed above is the first option. A lamprey is characterized by an absence of jaws. This animal is have no jaws and are only full of teeth. <span>Lampreys are any jawless fish of the order Petromyzontiformes. Hope this answers the question.</span>
4 0
3 years ago
Read 2 more answers
Bill the gardener plants snapdragons each year. Last year he planted white snapdragons and red snapdragons. He then collected th
omeli [17]

Answer:

Incomplete dominance

Explanation:

Incomplete dominance is a condition observed in the organisms while studying their genetics.

When the organisms with two alleles for the same trait are crossed, then neither of the two alleles completely express themselves but a new variation of the trait is formed.

This can be observed in the given scenario also when the ed and white flowers are crossed, then the pink flowers (a new variation of the trait) is formed called blended trait.

Thus, incomplete dominance is correct.

7 0
3 years ago
Which one(s) contribute the most to the mass of a plant? 1. Soil Il. Carbon III. Water es ) I only B) || only c) I and III only
Eva8 [605]

Explanation:

i guess tha answer should be D

4 0
3 years ago
Other questions:
  • How do photosynthesis and cellular respiration help each other convert energy?
    15·1 answer
  • What is the role of stomata in photosynthesis
    13·1 answer
  • How does inappropriate land use, such as removing vegetation from hillsides and plowing fields parallel to a hillside, affect th
    6·2 answers
  • In an animal cell , how is the DNA from the organelle inherited ?
    14·2 answers
  • Anole lizards mainly eat small insects. Suppose an anole lizard saw a bright red butterfly and ate it, but was ill afterwards. F
    15·2 answers
  • During the winter, air temperatures in the northern united states can remain below 0 c months; however, the fish and other anima
    5·2 answers
  • Why would satellite imagery be more useful than a map in some instances?
    9·1 answer
  • All cells share common traits that help scientists draw conclusions about the basic needs and functions of living organisms. Wha
    12·2 answers
  • Edpuzzle: Fermentation - Amoeba Sisters
    10·1 answer
  • What are the four ways in which soil is formed?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!